ID: 1170463529

View in Genome Browser
Species Human (GRCh38)
Location 20:16601434-16601456
Sequence TGAAGACCCCAAGGGATTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170463529_1170463535 16 Left 1170463529 20:16601434-16601456 CCAGAAATCCCTTGGGGTCTTCA No data
Right 1170463535 20:16601473-16601495 TCACATTTTAAGCACAGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170463529 Original CRISPR TGAAGACCCCAAGGGATTTC TGG (reversed) Intergenic