ID: 1170463531

View in Genome Browser
Species Human (GRCh38)
Location 20:16601442-16601464
Sequence GGCCAAGCTGAAGACCCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170463531_1170463535 8 Left 1170463531 20:16601442-16601464 CCCTTGGGGTCTTCAGCTTGGCC No data
Right 1170463535 20:16601473-16601495 TCACATTTTAAGCACAGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170463531 Original CRISPR GGCCAAGCTGAAGACCCCAA GGG (reversed) Intergenic