ID: 1170463532

View in Genome Browser
Species Human (GRCh38)
Location 20:16601443-16601465
Sequence TGGCCAAGCTGAAGACCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170463532_1170463535 7 Left 1170463532 20:16601443-16601465 CCTTGGGGTCTTCAGCTTGGCCA No data
Right 1170463535 20:16601473-16601495 TCACATTTTAAGCACAGTAATGG No data
1170463532_1170463536 30 Left 1170463532 20:16601443-16601465 CCTTGGGGTCTTCAGCTTGGCCA No data
Right 1170463536 20:16601496-16601518 TTCTCAACACCTATGCTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170463532 Original CRISPR TGGCCAAGCTGAAGACCCCA AGG (reversed) Intergenic