ID: 1170463535

View in Genome Browser
Species Human (GRCh38)
Location 20:16601473-16601495
Sequence TCACATTTTAAGCACAGTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170463524_1170463535 30 Left 1170463524 20:16601420-16601442 CCTACTTTTCTGTCCCAGAAATC No data
Right 1170463535 20:16601473-16601495 TCACATTTTAAGCACAGTAATGG No data
1170463528_1170463535 17 Left 1170463528 20:16601433-16601455 CCCAGAAATCCCTTGGGGTCTTC No data
Right 1170463535 20:16601473-16601495 TCACATTTTAAGCACAGTAATGG No data
1170463531_1170463535 8 Left 1170463531 20:16601442-16601464 CCCTTGGGGTCTTCAGCTTGGCC No data
Right 1170463535 20:16601473-16601495 TCACATTTTAAGCACAGTAATGG No data
1170463532_1170463535 7 Left 1170463532 20:16601443-16601465 CCTTGGGGTCTTCAGCTTGGCCA No data
Right 1170463535 20:16601473-16601495 TCACATTTTAAGCACAGTAATGG No data
1170463529_1170463535 16 Left 1170463529 20:16601434-16601456 CCAGAAATCCCTTGGGGTCTTCA No data
Right 1170463535 20:16601473-16601495 TCACATTTTAAGCACAGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170463535 Original CRISPR TCACATTTTAAGCACAGTAA TGG Intergenic