ID: 1170464746

View in Genome Browser
Species Human (GRCh38)
Location 20:16612305-16612327
Sequence CCACAGGCAATATGTGACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170464746_1170464749 1 Left 1170464746 20:16612305-16612327 CCAATGTCACATATTGCCTGTGG No data
Right 1170464749 20:16612329-16612351 TCTCAACTCAAATCTTAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170464746 Original CRISPR CCACAGGCAATATGTGACAT TGG (reversed) Intergenic
No off target data available for this crispr