ID: 1170470308

View in Genome Browser
Species Human (GRCh38)
Location 20:16661976-16661998
Sequence CCACTCTCCCAGCCAAGGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170470308_1170470316 5 Left 1170470308 20:16661976-16661998 CCCCCCCTTGGCTGGGAGAGTGG No data
Right 1170470316 20:16662004-16662026 GAGCCATGAGGAAACACCACAGG No data
1170470308_1170470315 -7 Left 1170470308 20:16661976-16661998 CCCCCCCTTGGCTGGGAGAGTGG No data
Right 1170470315 20:16661992-16662014 AGAGTGGATGCTGAGCCATGAGG No data
1170470308_1170470318 14 Left 1170470308 20:16661976-16661998 CCCCCCCTTGGCTGGGAGAGTGG No data
Right 1170470318 20:16662013-16662035 GGAAACACCACAGGATTCAATGG No data
1170470308_1170470319 20 Left 1170470308 20:16661976-16661998 CCCCCCCTTGGCTGGGAGAGTGG No data
Right 1170470319 20:16662019-16662041 ACCACAGGATTCAATGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170470308 Original CRISPR CCACTCTCCCAGCCAAGGGG GGG (reversed) Intergenic
No off target data available for this crispr