ID: 1170472645

View in Genome Browser
Species Human (GRCh38)
Location 20:16683623-16683645
Sequence ATCAAAAATGTCTCCAGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170472645_1170472648 20 Left 1170472645 20:16683623-16683645 CCTGGTCTGGAGACATTTTTGAT No data
Right 1170472648 20:16683666-16683688 TACTGAAATCTAATGGATAGAGG No data
1170472645_1170472647 13 Left 1170472645 20:16683623-16683645 CCTGGTCTGGAGACATTTTTGAT No data
Right 1170472647 20:16683659-16683681 AGGATGTTACTGAAATCTAATGG No data
1170472645_1170472649 25 Left 1170472645 20:16683623-16683645 CCTGGTCTGGAGACATTTTTGAT No data
Right 1170472649 20:16683671-16683693 AAATCTAATGGATAGAGGCCAGG No data
1170472645_1170472646 -7 Left 1170472645 20:16683623-16683645 CCTGGTCTGGAGACATTTTTGAT No data
Right 1170472646 20:16683639-16683661 TTTTGATCATCATAACTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170472645 Original CRISPR ATCAAAAATGTCTCCAGACC AGG (reversed) Intergenic
No off target data available for this crispr