ID: 1170472646

View in Genome Browser
Species Human (GRCh38)
Location 20:16683639-16683661
Sequence TTTTGATCATCATAACTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170472642_1170472646 28 Left 1170472642 20:16683588-16683610 CCAAGTTGCTGGGATTACAGATG 0: 21
1: 2455
2: 41296
3: 178794
4: 397037
Right 1170472646 20:16683639-16683661 TTTTGATCATCATAACTGAGAGG No data
1170472641_1170472646 29 Left 1170472641 20:16683587-16683609 CCCAAGTTGCTGGGATTACAGAT 0: 16
1: 1564
2: 31440
3: 219053
4: 578736
Right 1170472646 20:16683639-16683661 TTTTGATCATCATAACTGAGAGG No data
1170472645_1170472646 -7 Left 1170472645 20:16683623-16683645 CCTGGTCTGGAGACATTTTTGAT No data
Right 1170472646 20:16683639-16683661 TTTTGATCATCATAACTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170472646 Original CRISPR TTTTGATCATCATAACTGAG AGG Intergenic
No off target data available for this crispr