ID: 1170472649

View in Genome Browser
Species Human (GRCh38)
Location 20:16683671-16683693
Sequence AAATCTAATGGATAGAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170472645_1170472649 25 Left 1170472645 20:16683623-16683645 CCTGGTCTGGAGACATTTTTGAT No data
Right 1170472649 20:16683671-16683693 AAATCTAATGGATAGAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170472649 Original CRISPR AAATCTAATGGATAGAGGCC AGG Intergenic
No off target data available for this crispr