ID: 1170478788

View in Genome Browser
Species Human (GRCh38)
Location 20:16744448-16744470
Sequence GGGAGGCTCAATACAAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170478782_1170478788 14 Left 1170478782 20:16744411-16744433 CCCAGTTAAACTCACTTTCGGTC No data
Right 1170478788 20:16744448-16744470 GGGAGGCTCAATACAAATTGAGG No data
1170478783_1170478788 13 Left 1170478783 20:16744412-16744434 CCAGTTAAACTCACTTTCGGTCA No data
Right 1170478788 20:16744448-16744470 GGGAGGCTCAATACAAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170478788 Original CRISPR GGGAGGCTCAATACAAATTG AGG Intergenic
No off target data available for this crispr