ID: 1170478928

View in Genome Browser
Species Human (GRCh38)
Location 20:16745721-16745743
Sequence GCTCCTTTAGGATCTAAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170478928_1170478936 30 Left 1170478928 20:16745721-16745743 CCATGCTTAGATCCTAAAGGAGC No data
Right 1170478936 20:16745774-16745796 GAATCTAATTTAGGAACTGAAGG No data
1170478928_1170478935 21 Left 1170478928 20:16745721-16745743 CCATGCTTAGATCCTAAAGGAGC No data
Right 1170478935 20:16745765-16745787 CCAGACAGAGAATCTAATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170478928 Original CRISPR GCTCCTTTAGGATCTAAGCA TGG (reversed) Intergenic
No off target data available for this crispr