ID: 1170481014

View in Genome Browser
Species Human (GRCh38)
Location 20:16764837-16764859
Sequence ATAAAGGAATACTTGAGGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 17120
Summary {0: 36, 1: 475, 2: 1507, 3: 4176, 4: 10926}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170481014_1170481019 22 Left 1170481014 20:16764837-16764859 CCTAGCCTCAAGTATTCCTTTAT 0: 36
1: 475
2: 1507
3: 4176
4: 10926
Right 1170481019 20:16764882-16764904 CACTACCCACTAGTGGAACTTGG 0: 1
1: 0
2: 0
3: 1
4: 60
1170481014_1170481018 15 Left 1170481014 20:16764837-16764859 CCTAGCCTCAAGTATTCCTTTAT 0: 36
1: 475
2: 1507
3: 4176
4: 10926
Right 1170481018 20:16764875-16764897 AGTGAGACACTACCCACTAGTGG 0: 1
1: 0
2: 0
3: 12
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170481014 Original CRISPR ATAAAGGAATACTTGAGGCT AGG (reversed) Intronic
Too many off-targets to display for this crispr