ID: 1170481016

View in Genome Browser
Species Human (GRCh38)
Location 20:16764842-16764864
Sequence TTCCTATAAAGGAATACTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3590
Summary {0: 2, 1: 52, 2: 552, 3: 1267, 4: 1717}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170481016_1170481018 10 Left 1170481016 20:16764842-16764864 CCTCAAGTATTCCTTTATAGGAA 0: 2
1: 52
2: 552
3: 1267
4: 1717
Right 1170481018 20:16764875-16764897 AGTGAGACACTACCCACTAGTGG 0: 1
1: 0
2: 0
3: 12
4: 142
1170481016_1170481019 17 Left 1170481016 20:16764842-16764864 CCTCAAGTATTCCTTTATAGGAA 0: 2
1: 52
2: 552
3: 1267
4: 1717
Right 1170481019 20:16764882-16764904 CACTACCCACTAGTGGAACTTGG 0: 1
1: 0
2: 0
3: 1
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170481016 Original CRISPR TTCCTATAAAGGAATACTTG AGG (reversed) Intronic
Too many off-targets to display for this crispr