ID: 1170481017

View in Genome Browser
Species Human (GRCh38)
Location 20:16764853-16764875
Sequence TCTGTTTAGTGTTCCTATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1094
Summary {0: 1, 1: 15, 2: 94, 3: 275, 4: 709}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170481017_1170481018 -1 Left 1170481017 20:16764853-16764875 CCTTTATAGGAACACTAAACAGA 0: 1
1: 15
2: 94
3: 275
4: 709
Right 1170481018 20:16764875-16764897 AGTGAGACACTACCCACTAGTGG 0: 1
1: 0
2: 0
3: 12
4: 142
1170481017_1170481019 6 Left 1170481017 20:16764853-16764875 CCTTTATAGGAACACTAAACAGA 0: 1
1: 15
2: 94
3: 275
4: 709
Right 1170481019 20:16764882-16764904 CACTACCCACTAGTGGAACTTGG 0: 1
1: 0
2: 0
3: 1
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170481017 Original CRISPR TCTGTTTAGTGTTCCTATAA AGG (reversed) Intronic
901161769 1:7183011-7183033 TCTGTTTTGCATTGCTATAAAGG + Intronic
902097323 1:13957478-13957500 TCCATTTAGTGTTGCTATAAGGG + Intergenic
902102771 1:14006213-14006235 TCTGTTTTGCATTGCTATAAAGG + Intergenic
902189474 1:14751887-14751909 TCTGTTTTGTATTGCTATAAAGG + Intronic
902689021 1:18098097-18098119 TCCATTTTGTGTTTCTATAAAGG - Intergenic
902739746 1:18428458-18428480 TGTGCTTAGTGTTCCAGTAATGG + Intergenic
902969576 1:20037646-20037668 TCTGTTATGAGTTGCTATAATGG + Intronic
903002821 1:20278586-20278608 TCCATTTTGTGTTGCTATAAAGG + Intergenic
903834607 1:26195256-26195278 TCCATTTAGTGTTGCTATAAAGG + Intronic
903960117 1:27051745-27051767 CATGCTTAGTGTTCCAATAATGG + Intergenic
904514318 1:31041832-31041854 TCCATTTTGTGTTGCTATAAAGG - Intronic
904580585 1:31540946-31540968 TCTGTTTTGCGTTGCTACAAAGG + Intergenic
904894953 1:33809999-33810021 TTTGTTTAGGGTTTCTTTAATGG - Intronic
905258756 1:36702894-36702916 TCCGTTTTGTGTCACTATAAAGG + Intergenic
906085831 1:43133515-43133537 TCTGTTTGGTTTTGCTATCAGGG + Intergenic
906246181 1:44275862-44275884 TCCATTTTGTGTTGCTATAAAGG + Intronic
906771669 1:48490538-48490560 TCTATTTAATGTTCATTTAATGG + Intergenic
906861684 1:49367544-49367566 TCTACTTTGTGTTACTATAAAGG - Intronic
907633396 1:56107144-56107166 TCTGTTTTGAGTTGCTGTAATGG - Intergenic
907709051 1:56860972-56860994 TCAGTTTTGTGTTGTTATAAAGG + Intronic
907777996 1:57537755-57537777 TCTGTTTTGTGTTGCTATAAAGG + Intronic
907817081 1:57929568-57929590 TCTGTTTTATGTTGCTATAAAGG + Intronic
907844696 1:58193432-58193454 TCTGTTTTGTATTGCTACAAAGG - Intronic
907906917 1:58790947-58790969 TCTCTTTTGTGTTGCTATAAAGG + Intergenic
908012798 1:59798399-59798421 TCTGTTTTGCATTGCTATAAAGG - Intergenic
908032379 1:60015213-60015235 TGGGATTAGTGTTCTTATAAAGG + Intronic
908797347 1:67843806-67843828 TCTGTTTTATGTTGCTATAAAGG - Intergenic
909154632 1:72057838-72057860 TCTGTTTTCTCTTCTTATAATGG + Intronic
909286766 1:73829410-73829432 CATGCTTAGTGTTCCAATAATGG - Intergenic
909492515 1:76241212-76241234 TCTGTTTTGTGTTGCTATAAAGG + Intronic
909956824 1:81788577-81788599 TCTGTTTTGCATTCCTATAAAGG - Intronic
909989886 1:82210620-82210642 TCCATTTTGTGTTGCTATAAAGG - Intergenic
910076861 1:83290876-83290898 TCCATTTAGTGTTGCTATAAAGG - Intergenic
910304208 1:85742883-85742905 CATGCTTAGTGTTCCAATAATGG + Intronic
910724350 1:90323050-90323072 TCTGTTTTGTGTTGCTATAGAGG + Intergenic
910975051 1:92897784-92897806 TTTGTTTTGTGTCACTATAAAGG + Intronic
911266569 1:95751549-95751571 TCTGTTTTGTATTGCTACAAAGG - Intergenic
911498331 1:98657429-98657451 TCTGTTTTGTATTGCTATGAAGG + Intergenic
911626971 1:100134782-100134804 GCTGATTAGTATTCCTATAGAGG + Intronic
911650175 1:100379653-100379675 TCTGTTTTGCATTGCTATAAAGG + Intronic
911879885 1:103224029-103224051 TCTATTTTGTATTGCTATAAAGG - Intergenic
912268526 1:108185231-108185253 TCTGTTTTCTGTTGCTGTAATGG - Intronic
912269861 1:108198213-108198235 TCCATTTAGTGTTGCTATAGTGG - Intronic
912734197 1:112135535-112135557 TCTATTTAGTGTTCCAATTCAGG - Intergenic
913359050 1:117958833-117958855 TCTGTTTACTGTTTCTAGAAGGG + Intronic
914264887 1:146030195-146030217 TTCATTTAGTGTTGCTATAAAGG + Intergenic
914895499 1:151667960-151667982 TCCATTTTGTGTTGCTATAAAGG + Intronic
915730743 1:158052435-158052457 TCCATTTTGTGTTGCTATAAAGG + Intronic
915777628 1:158507650-158507672 TCAATTTGGTGTTCCTATGAGGG + Intergenic
916518696 1:165544136-165544158 TCTGTTCAGTTCTCCTGTAATGG + Exonic
916527547 1:165625725-165625747 CCTGTTTTGTGCTGCTATAATGG - Intergenic
917265051 1:173211904-173211926 TCTATTTTGTGTTGCTGTAAAGG + Intergenic
917452827 1:175161439-175161461 TGTGTTCAGTGTTCTGATAAGGG + Intronic
917775864 1:178333472-178333494 AAAGTTTAGTGTTCCAATAATGG - Intronic
918364067 1:183788026-183788048 TCCATTTTGTGTTGCTATAAAGG - Intronic
918666568 1:187158033-187158055 TGTGTCTTGTGTTACTATAAAGG - Intergenic
918742081 1:188145115-188145137 TCTTTTGAGTGATCCTATAGAGG + Intergenic
919026124 1:192172534-192172556 TCTGTTTTGTGTTGCTATAAAGG - Intronic
919598163 1:199590337-199590359 TCTGTTTTGTGCTGCTATGAAGG - Intergenic
920159530 1:203985657-203985679 TTTGTTTTCTGTTGCTATAATGG + Intergenic
920460737 1:206138051-206138073 TCCATTTTGTGTTGCTATAAAGG + Intergenic
920510491 1:206548194-206548216 TCTGTTTTGTGTTACTATGAAGG + Intronic
921111729 1:212044848-212044870 TCTGTCTTCTGTTGCTATAAAGG + Intronic
921231833 1:213081158-213081180 TCTGTGTAGTGTTGCTACAAAGG + Intronic
921510505 1:216022214-216022236 TCCATTTAGTGTTCCTATAAAGG - Intronic
921775065 1:219088502-219088524 TCGATTTAGTGTTCCTGTAGGGG - Intergenic
921887307 1:220319941-220319963 TCTGTTTTGTTTTGCTATAAAGG - Intergenic
922348305 1:224715514-224715536 TCTGTTTTGTGTTACTATCAAGG + Intronic
922358847 1:224802436-224802458 TCTGTTTTGTGTTGCTATAAAGG - Intergenic
922812937 1:228428086-228428108 TCTGTTTTGCGTTGCTGTAAAGG + Intergenic
922876747 1:228945745-228945767 TCCATTTTGTGTTGCTATAAAGG + Intergenic
923218174 1:231869432-231869454 TCCATTTTGTGTTGCTATAATGG + Intronic
923265874 1:232313630-232313652 TTTGTTTTATGTTGCTATAACGG - Intergenic
923442750 1:234037060-234037082 TCTGTTTTGTGTTGCTATAAAGG + Intronic
923468609 1:234270017-234270039 TCCATTTAGTGTTGCTATAAAGG - Intronic
923621926 1:235586878-235586900 GCTGTTTTGTGTTGCTGTAAAGG - Intronic
924050518 1:240075834-240075856 TCTGTTTTGTGTTGCTATAAAGG + Intronic
924174281 1:241373763-241373785 TCCATTTTGTGTTGCTATAAAGG - Intergenic
924294399 1:242570708-242570730 TCTGCTTTGCGTTGCTATAAAGG + Intergenic
924433817 1:244020984-244021006 TCGCTTTTGTGTTGCTATAAAGG - Intergenic
924768056 1:247052688-247052710 TCTGTTATGAGTTGCTATAATGG + Intronic
1063105182 10:2986478-2986500 AGTGTTTAGTGTTCTTTTAAAGG + Intergenic
1063222312 10:3980437-3980459 TCTTTTTAGTCTTCTTTTAATGG + Intergenic
1063287832 10:4709584-4709606 TCCACTTAGTGTTGCTATAATGG - Intergenic
1063340001 10:5253866-5253888 TCCATTTATTGTTGCTATAAAGG + Intergenic
1063343735 10:5292785-5292807 TCCATTTATTGTTGCTATAAAGG - Intergenic
1063860746 10:10305322-10305344 TCTGTTTTATTTTCCTATATTGG + Intergenic
1065078690 10:22106417-22106439 TCTGTTTTGTATTGCTATAAAGG + Intergenic
1065084713 10:22163267-22163289 TCAGTCTTGTGTTGCTATAAAGG + Intergenic
1065246467 10:23763785-23763807 TCTGTTTCATGTTGCTGTAAAGG + Intronic
1065283804 10:24167753-24167775 TCTGTTTTGTGCTGCTGTAATGG + Intronic
1065668407 10:28087353-28087375 TCTGTTGTGTGTTGCTGTAAAGG - Intronic
1065675859 10:28173653-28173675 TTTGTTTTGTGTTGCTACAAAGG - Intronic
1065675955 10:28174611-28174633 TTTGTTTTGTGTTGCTACAAAGG - Intronic
1065772893 10:29094107-29094129 TCCATTTTGTGTTGCTATAAAGG + Intergenic
1065842299 10:29712607-29712629 TCCCTTTAGTGTTGCTATAAAGG - Intronic
1065863092 10:29887837-29887859 TCTGTTTTGCATTTCTATAAAGG - Intergenic
1065902930 10:30224327-30224349 TCTGTTTTTTGTTGCTATAAAGG - Intergenic
1066061979 10:31732198-31732220 TCCATTTAGTATTGCTATAAAGG + Intergenic
1066066460 10:31764821-31764843 TCCGTTTTGTGTTCCTATAAAGG - Intergenic
1067140660 10:43653653-43653675 TCCATTTAGTGTTGCTATAAAGG + Intergenic
1067141637 10:43662718-43662740 TCTTTTTAGTGTTGCTATACAGG + Intergenic
1067246482 10:44551139-44551161 TCTGTTTTGTATTGCTATAAAGG + Intergenic
1068056550 10:52018923-52018945 TCTGCTTCGTGTTGCTAAAAAGG + Intronic
1068069740 10:52181339-52181361 TCTGTTTTGTGTTGCTGTGAAGG + Intronic
1068149385 10:53112763-53112785 TCTGTTTGGTGTACCTGAAAGGG + Intergenic
1068944662 10:62717768-62717790 TCTGTTTTGTATTATTATAAAGG + Intergenic
1069045352 10:63737450-63737472 TCTATTTTGTGTTGCTTTAAAGG - Intergenic
1069088635 10:64172700-64172722 TTTGTTTAGTTTTCCTCTAGGGG + Intergenic
1069152456 10:64981361-64981383 TCTGTTTCGTGCTACTATAAAGG + Intergenic
1069787695 10:70999165-70999187 TCTGTTTTGTGTTGCTATAAAGG - Intergenic
1070052709 10:72904823-72904845 TTTGTTTAGTGTTGCTATAAAGG + Intronic
1070716248 10:78724166-78724188 TCTGTTTTGTGCTTCTATCAAGG + Intergenic
1071129170 10:82371608-82371630 TCTGTTTTGTGTTGCTGTAAAGG + Intronic
1071934376 10:90511201-90511223 TCTGTTTAGTGTTACTATAAGGG + Intergenic
1072477095 10:95772878-95772900 TTTGTTTTGTGTTGCTATAAAGG + Intronic
1073080374 10:100856137-100856159 TCTGTCTTCTGTTACTATAAAGG - Intergenic
1073478294 10:103768755-103768777 TCTGTTTAATGTTGCTATAAAGG + Intronic
1073732842 10:106310973-106310995 TCCATTTTGTGTTGCTATAAAGG - Intergenic
1074298654 10:112213590-112213612 TATGGTTAGTGGTCCAATAAGGG + Intronic
1074440277 10:113471832-113471854 TCCATTTTGTGTTGCTATAAAGG + Intergenic
1074600034 10:114904690-114904712 TCTGTTTTGCCTTGCTATAAAGG + Intergenic
1074982687 10:118632429-118632451 TCTGTTTAGTGTTGCCATAATGG - Intergenic
1075372410 10:121949129-121949151 TCTGTCCAGTGTTAATATAAAGG + Intergenic
1075427682 10:122354454-122354476 TCTGTTTTGCATTGCTATAAGGG - Intergenic
1076024224 10:127099399-127099421 TCTCTTTTGCGTTGCTATAAAGG + Intronic
1076064689 10:127439962-127439984 TCTGTTTTGTGTTACTGCAAAGG + Intronic
1076125846 10:127973036-127973058 TCTGTTTTGTCTACCTAGAAAGG - Intronic
1076251177 10:128984901-128984923 TCTGTTTTGTGTTGCTACAAAGG - Intergenic
1076277541 10:129216125-129216147 TCTTTTTATTGTTCTTATATAGG - Intergenic
1076926609 10:133493570-133493592 TCCATTTAGTGTTGCTATAAAGG + Intergenic
1076932758 10:133544518-133544540 TCTGTTTAGTGTTGCTATAAAGG + Intronic
1077447691 11:2606672-2606694 CCAGTTTTGTGTTACTATAAAGG - Intronic
1077751172 11:4971650-4971672 TCTGTTTTGTGTTGCTGTAAAGG + Intronic
1078297478 11:10088415-10088437 TCTGTTTATTATTGCTATAAAGG + Intronic
1078415907 11:11164662-11164684 TCTGTTTAGTATTGCTCTAAAGG + Intergenic
1078591697 11:12646708-12646730 TCCATTTAGTGTTGCTATAAAGG - Intergenic
1079667326 11:23122014-23122036 TCTGTTTTGTGTTGCTATAAAGG - Intergenic
1079850193 11:25523213-25523235 TCTATGTAGTATTGCTATAAAGG - Intergenic
1080181802 11:29434404-29434426 TCCATTTAGTGTTGTTATAAAGG - Intergenic
1080878748 11:36300134-36300156 TCTGTTTTGTGTTGCTGTAAAGG + Intronic
1081071025 11:38608530-38608552 TCCGTTGTGTGTTACTATAAAGG + Intergenic
1081270121 11:41073117-41073139 TCTGTTTTGTGTTACTGTAAAGG + Intronic
1081311854 11:41583948-41583970 CATGCTTAGTGTTCCCATAATGG + Intergenic
1081319033 11:41668142-41668164 TGAGTTTAGTGTTCCTGTGAGGG - Intergenic
1081359188 11:42152253-42152275 TTTTTTTAGTGTTTCTATGATGG + Intergenic
1081529277 11:43946980-43947002 TCCGTTCTGTGTTGCTATAAGGG + Intergenic
1082164220 11:48925379-48925401 TCTGTCTAGTGTTTATATGAAGG + Intergenic
1082164227 11:48925550-48925572 TCTGTCTAGTGTTTATATGAAGG + Intergenic
1082670552 11:56031812-56031834 GATGCTTAGTGTTCCAATAATGG - Intergenic
1082862185 11:57867346-57867368 TCTGTTTTGTGTTGCTATTAAGG + Intergenic
1082862536 11:57869661-57869683 TCTATTTTGCGTTGCTATAAAGG + Intergenic
1083207040 11:61158113-61158135 TCTGTTTTGCATTGCTATAAAGG - Intronic
1085110931 11:73887150-73887172 TCTGTTTAGTGTTGCTATAAAGG - Intronic
1085719441 11:78899937-78899959 TCCATTTAGTGTTGCTATAAAGG - Intronic
1085971032 11:81590782-81590804 TCTATTTTGTGTTGCTATACAGG + Intergenic
1086314374 11:85574878-85574900 TCTGTTTTGTGTTGCTGTAAAGG - Intronic
1086391596 11:86370563-86370585 TCTGTTTTGTGTTGTTGTAAAGG - Intergenic
1086445540 11:86867005-86867027 TTTGTTTTGTGTTGCTATAAAGG - Intronic
1087186657 11:95205998-95206020 TATGTGAAGTGTTCATATAAGGG - Intronic
1087405263 11:97722211-97722233 TCTGTCTTGAGTTGCTATAATGG - Intergenic
1087618553 11:100517164-100517186 TCTGTTTAATGTTGCTATAAAGG + Intergenic
1087623040 11:100564372-100564394 TCTGTTTTGTGTTGCTGTACAGG + Intergenic
1087789168 11:102389231-102389253 TCTATTTTGTGTTGCTATGAAGG + Intergenic
1088546596 11:110965709-110965731 TCTATTTTGTATTGCTATAAAGG + Intergenic
1088554389 11:111047286-111047308 TCTGTTTTGTGTTGCTATAAAGG + Intergenic
1088657394 11:112013778-112013800 TCAGTTGAGTGTTGCCATAAAGG + Intronic
1088961438 11:114669845-114669867 CATGCTTAGTGTTCCAATAATGG - Intergenic
1089942076 11:122429370-122429392 TCTGTTTCCTGCTGCTATAACGG - Intergenic
1090143698 11:124294520-124294542 CATGCTTAGTGTTCCAATAATGG - Intergenic
1090539934 11:127690498-127690520 TCTATTTTTTGTTGCTATAAAGG + Intergenic
1090684533 11:129100673-129100695 TCTGTGCAGTGTTAGTATAAGGG - Intronic
1090815863 11:130294713-130294735 CATGCTTAGTGTTCCAATAATGG + Intronic
1090943679 11:131410791-131410813 CATGTTTAGCGTTCCAATAATGG - Intronic
1090981758 11:131728598-131728620 CATGCTTAGTGTTCCAATAATGG - Intronic
1091196537 11:133736183-133736205 TGTGTTTTGTGTAGCTATAAAGG + Intergenic
1091497897 12:988492-988514 TCTATTTTATGTTGCTATAAAGG + Intronic
1091523796 12:1275712-1275734 TCCATTTAGTGTTGCTATAAAGG + Intronic
1091772530 12:3162327-3162349 TCTGTTTTGTGTTGTTATAAAGG - Intronic
1092168744 12:6360078-6360100 TCCATTTTGTGTTGCTATAAAGG - Intronic
1092724970 12:11475951-11475973 TCTATTTTGTATTCCTATAAAGG - Intronic
1093295284 12:17382172-17382194 TCTGTTTTGTGCTTTTATAATGG - Intergenic
1093325101 12:17764165-17764187 CATGCTTAGTGTTCCAATAATGG + Intergenic
1093334172 12:17880360-17880382 TCTGTTTAGTGTTGCTATAAAGG + Intergenic
1094023979 12:25942839-25942861 TCTGTTTTGTGTTGCTAAAAAGG + Intergenic
1094023982 12:25942919-25942941 AATGTTTTGTGTTGCTATAAAGG + Intergenic
1094063920 12:26343175-26343197 TCTGTTTTGTGTTGCTGTGAAGG - Intronic
1094228952 12:28080834-28080856 TCTGTTTTGCGTTGATATAAAGG - Intergenic
1094263797 12:28531050-28531072 TCCGTTTTGTGTTGCTATAATGG - Intronic
1094671552 12:32575190-32575212 GCTGTTTAGTGTTGTTATATGGG + Intronic
1094717262 12:33024860-33024882 TATGTTTTGTGTTGCCATAAAGG - Intergenic
1095037519 12:37404917-37404939 TCTGTCTAGTTTTTATATAAAGG - Intergenic
1095037693 12:37408149-37408171 TCTGTCTAGTTTTCCTGTGAAGG - Intergenic
1096236755 12:49933717-49933739 TCCATTTTGTGTTGCTATAAAGG + Intergenic
1097563107 12:61233341-61233363 CATGCTTAGTGTTCCAATAATGG + Intergenic
1097647151 12:62249965-62249987 TCCATTTAGTGTTACTCTAAAGG + Intronic
1097870299 12:64596372-64596394 TCTGTTTTGTGTTGCTATAAAGG + Intergenic
1098039409 12:66339077-66339099 CATGTTTAGTGTCCCAATAATGG - Exonic
1098118932 12:67214465-67214487 TCTGTTTTGCGTTGCCATAAAGG + Intergenic
1098120974 12:67237588-67237610 TCCATTTAGTGTTGCTGTAAAGG - Intergenic
1098504521 12:71233731-71233753 TTTGTGTAATGTTGCTATAATGG - Intronic
1099359597 12:81683731-81683753 TCCATTTTGTGTTGCTATAAAGG + Intronic
1099396861 12:82151041-82151063 CATGCTTAGTGTTCCAATAATGG + Intergenic
1099442780 12:82718054-82718076 TAAGCTTAGTGTTCCAATAATGG - Intronic
1099854935 12:88152108-88152130 TCTGTTTTGCGTTAGTATAAAGG + Intronic
1100042796 12:90341288-90341310 CATGCTTAGTGTTCCAATAATGG + Intergenic
1100216198 12:92451334-92451356 TCTGTTCTGTGTTTCTATAATGG + Intergenic
1101021301 12:100557089-100557111 TCTGTTTTGCATTGCTATAAAGG + Intronic
1101505065 12:105338519-105338541 TCATTTTTGTGTTGCTATAAAGG + Intronic
1101637963 12:106561925-106561947 TTTATTTAGTGTTGCTATAAAGG - Intronic
1101638625 12:106568569-106568591 TCTGTTTTGTGTTGCCATGAAGG - Intronic
1101844774 12:108354236-108354258 TCCATTTTGTGTTGCTATAAAGG + Intergenic
1101977814 12:109377181-109377203 TCCATTTTGTGTTGCTATAAAGG + Intronic
1102630482 12:114274512-114274534 TCCATTTTGTGTTGCTATAAAGG + Intergenic
1102786620 12:115610375-115610397 TCCATTTTGTGTTGCTATAAAGG + Intergenic
1102850838 12:116243360-116243382 CAAGTTTAGTGTTCCAATAATGG + Intronic
1104140004 12:125978936-125978958 TTAGTTTAGTGTTGCTATAAAGG + Intergenic
1104411738 12:128563948-128563970 CATGCTTAGTGTTCCAATAATGG + Intronic
1104542205 12:129676398-129676420 TCTGTTTTGCGTTGCTATAAAGG + Intronic
1104742309 12:131187721-131187743 TCCATTTAGTGCTGCTATAATGG + Intergenic
1105331756 13:19423592-19423614 TATGCTTAGCGTTCCAATAATGG + Intronic
1105339733 13:19510228-19510250 TCTGTTTAGTGTTGCCATAAGGG + Intronic
1105832995 13:24182289-24182311 TCTTTTTTGTTTTGCTATAAAGG + Intronic
1105989830 13:25608049-25608071 TCTATTTTGTGTTGCTATAAAGG + Intronic
1106422970 13:29598880-29598902 TTTGTTTTGTATTGCTATAATGG + Intergenic
1106484813 13:30162764-30162786 TCTGTTTTGCATTGCTATAAAGG + Intergenic
1106564987 13:30876603-30876625 CATGCTTAGTGTTCCAATAATGG - Intergenic
1106731459 13:32545445-32545467 TCCATTTTGTGTTGCTATAAGGG - Intergenic
1106970114 13:35129495-35129517 TCTGTTTAATGTTTCCATATAGG - Intronic
1107181342 13:37463534-37463556 TTCGTTTAGTGTTGCTATAAAGG + Intergenic
1107267952 13:38579735-38579757 TCCATTTAGTGTTGCTATAAAGG - Intergenic
1107540257 13:41382859-41382881 TCTGTTTTCTGTTGCTGTAATGG + Intergenic
1107650655 13:42541507-42541529 TGCATTTAGTGTTGCTATAAAGG - Intergenic
1107858250 13:44636179-44636201 TCCATTTTGTGTTTCTATAAAGG - Intergenic
1108039447 13:46325613-46325635 TCCATTTTGTGTTGCTATAAAGG - Intergenic
1108069616 13:46615120-46615142 TCTGTTCTGTGTTGCAATAAAGG + Intronic
1108100919 13:46954010-46954032 TCTGTTTAATTTTACAATAAAGG - Intergenic
1108199688 13:48030903-48030925 TCTGTTTTGTGCCACTATAAGGG + Intergenic
1109075858 13:57833338-57833360 TCTGTTTAGTGTTACTCTAAAGG - Intergenic
1109632878 13:65076027-65076049 CATGTTTAGAGTTCCAATAATGG + Intergenic
1109825291 13:67711249-67711271 TGTATATAGTGCTCCTATAATGG - Intergenic
1109847061 13:68007375-68007397 TCTATTAAGTTTTCCTATTATGG + Intergenic
1109872608 13:68353578-68353600 TCTGTTTTGCATTGCTATAAAGG - Intergenic
1109913430 13:68947575-68947597 TCTGTTTTGTGTTGCTATAATGG + Intergenic
1109946651 13:69442952-69442974 TCTGTTTTGCATTGCTATAATGG - Intergenic
1109978373 13:69872029-69872051 TCTGTTTTGTGTTGCTATAAAGG + Intronic
1110480373 13:75967119-75967141 TCTGTTAAGTGTCCTTTTAATGG - Intergenic
1110603997 13:77409917-77409939 TCTGTTTTGTGTTGCTGTAATGG + Intergenic
1110805769 13:79752297-79752319 TCCTTTTAGTGTTGCTATAAAGG - Intergenic
1110849502 13:80229021-80229043 TCTGTTTTGTGTAGCTATAAAGG + Intergenic
1110874759 13:80494729-80494751 TTGGTTTAGTGTTGCTATAAAGG - Intergenic
1111099476 13:83563850-83563872 TCTGTTTTGAGTTGCTGTAAAGG - Intergenic
1111327565 13:86719221-86719243 TTTGTTTTGTGTTGCTATAAAGG - Intergenic
1111400721 13:87731275-87731297 TGTGATTTGTGTACCTATAAAGG - Intergenic
1111552841 13:89838471-89838493 TCTGTTTTATGTTGCTATAAAGG + Intergenic
1111659802 13:91194600-91194622 TCCATTTTGTGTTGCTATAAAGG - Intergenic
1111668312 13:91297166-91297188 TTTATTTAGTGTTGCTATAAAGG - Intergenic
1111803416 13:93007272-93007294 TCTGTTTTGTATTGCTATAAAGG + Intergenic
1111846764 13:93519441-93519463 TTTGTTTAGTGTTTCTATCTTGG - Intronic
1112044171 13:95579039-95579061 CATGCTTAGTGTTCCAATAATGG - Exonic
1112093745 13:96110045-96110067 TCCATTTTGTGTTGCTATAAAGG + Intronic
1112133551 13:96550482-96550504 TCTGTTTTGCATTACTATAAAGG - Intronic
1112738244 13:102444761-102444783 TCTGATTAGTTTTCCTTTATAGG - Intergenic
1113107540 13:106787747-106787769 TCTATTTATTATTCCTAGAAAGG + Intergenic
1113584513 13:111455573-111455595 TCTGCTTTGTGTTGCTATAAAGG - Intergenic
1114037206 14:18640827-18640849 TCTATTTAGTGGTTCTAAAATGG + Intergenic
1114121435 14:19674216-19674238 TCTATTTAGTGGTTCTAAAATGG - Intergenic
1114539529 14:23444453-23444475 GCTGTTCTGTGTTCCTATGAGGG + Intergenic
1114601695 14:23960767-23960789 TCTGTTTTGCATTGCTATAAAGG + Intronic
1114605864 14:23995888-23995910 TCTGTTTTGCATTGCTATAAAGG + Intronic
1114611370 14:24043444-24043466 TCTGTTTTGCGTTGCTATAAAGG + Intergenic
1114764220 14:25351931-25351953 TCTGTTTTGTGTTACTATAAAGG + Intergenic
1115151089 14:30286574-30286596 TCTGTTTTGTGTTGCTATAAAGG + Intergenic
1115229842 14:31148062-31148084 TATGTTTATTTTACCTATAATGG - Intronic
1115282706 14:31682788-31682810 TCCATTTAGTGTTGCTATAAAGG + Intronic
1115318586 14:32053343-32053365 TCTGTTTTGCATTGCTATAAAGG + Intergenic
1115395594 14:32904965-32904987 TATGTTTAGTGTTCCATTATTGG - Intergenic
1115505697 14:34092428-34092450 TCTGTTTTGTATTACTATAAAGG + Intronic
1115534121 14:34356648-34356670 TCTGTTTTGTGTTGCTATAAAGG - Intronic
1115764798 14:36612761-36612783 TCTGTTTTGTGTTGCTGTAACGG + Intergenic
1115929155 14:38471439-38471461 TCTGTTTTGTGTTGCTACAAAGG + Intergenic
1116340803 14:43721530-43721552 TCTGTTTTATGTTGCTATAAAGG + Intergenic
1116420539 14:44727153-44727175 TCTGTTTCATGTTGCTTTAAAGG - Intergenic
1116505888 14:45680926-45680948 TCTTTTTTGTGTTGTTATAAAGG + Intergenic
1116521118 14:45848292-45848314 TCTGTTTTGTGTGGCTATAAAGG + Intergenic
1116776275 14:49184949-49184971 TCCATTTTGTGTTGCTATAAAGG + Intergenic
1117009073 14:51451910-51451932 TCTGTTTTGCATTGCTATAAAGG - Intergenic
1117675705 14:58152611-58152633 TCTGTGTAGAGTTACTTTAAGGG - Intronic
1118038085 14:61889832-61889854 TCTGTTTTGTGTTGGTATAAAGG - Intergenic
1118072646 14:62262871-62262893 CATGCTTAGTGTTCCAATAATGG + Intergenic
1118173391 14:63411883-63411905 TCTATTTTGTGTTGCTGTAAAGG - Intronic
1118301627 14:64621897-64621919 TCTGTTGTGTGTTGTTATAAAGG - Intergenic
1118673398 14:68155622-68155644 TCTTCTTATGGTTCCTATAATGG + Intronic
1118843909 14:69532156-69532178 TTTGTTTAGTAATCATATAAAGG + Intergenic
1120011460 14:79420438-79420460 CATGCTTAGTGTTCCAATAATGG + Intronic
1120133461 14:80835300-80835322 TCTGTTTTGTGTTACACTAAAGG - Intronic
1120179482 14:81329000-81329022 TCTATTTTGTGTTGCTATAGAGG - Intronic
1120360200 14:83490879-83490901 TTTGTTTATTGTTGATATAAAGG - Intergenic
1120574958 14:86170258-86170280 TCTGTTTTGCATTACTATAAAGG - Intergenic
1120724480 14:87922573-87922595 TCACTTTTGTGTTACTATAAAGG + Intronic
1120733724 14:88030490-88030512 TCCATTTAGTATTGCTATAAAGG - Intergenic
1121054360 14:90840705-90840727 TCCATTTTGTGTTTCTATAAAGG - Intergenic
1121215684 14:92245937-92245959 TCCATTTAGTATTGCTATAAAGG + Intergenic
1121240450 14:92426150-92426172 TCTGTTTAGTGTTACTAAAAAGG + Intronic
1122029705 14:98903276-98903298 TCTGTTTTGTGTTGCTATAAAGG - Intergenic
1122182055 14:99962466-99962488 TCTGTTTACTGTTGCTATAAAGG - Intergenic
1122390674 14:101380490-101380512 TCTGTTTAGTGTTGCTGTAAAGG + Intergenic
1122432363 14:101662034-101662056 TCTGTTTTGCATTGCTATAAAGG - Intergenic
1122563000 14:102630412-102630434 TCCCTTTAGTGTTCCTATAAAGG - Intronic
1122831480 14:104399390-104399412 TCTGTTTTGTGTTGCTATAAGGG - Intergenic
1123259211 15:17605916-17605938 TCTGTGTAGTTTTCATATAAAGG - Intergenic
1123262507 15:17663965-17663987 TCTGTGTAGTTTTCATATAAAGG - Intergenic
1123265419 15:17715009-17715031 TCTGTGTAGTTTTCATATAAAGG - Intergenic
1123266973 15:17742323-17742345 TCTGTGTAGTTTTCATATAAAGG - Intergenic
1123278681 15:17947939-17947961 TCTGTGTAGTTTTCATATAAAGG - Intergenic
1123279557 15:17963312-17963334 TCTGTGTAGTTTTCATATAAAGG - Intergenic
1123281015 15:17988924-17988946 TCTGTGTAGTTTTCATATAAAGG - Intergenic
1123283730 15:18036735-18036757 TCTGTGTAGTTTTCATATAAAGG - Intergenic
1123284487 15:18050226-18050248 TCTGTGTAGTTTTCATATAAAGG - Intergenic
1123284878 15:18057054-18057076 TCTGTGTAGTTTTCATATAAAGG - Intergenic
1123286428 15:18084372-18084394 TCTGTGTAGTTTTCATATAAAGG - Intergenic
1123294612 15:18227804-18227826 TCTGTGTAGTTTTCATATAAAGG - Intergenic
1123295783 15:18248293-18248315 TCTGTGTAGTTTTCATATAAAGG - Intergenic
1123482930 15:20651641-20651663 TCTGTTTACTGTTTCCATATAGG + Intergenic
1123978739 15:25578862-25578884 TCAGTTTTCTGTTGCTATAATGG - Intergenic
1124006019 15:25796100-25796122 TTCGTTTTGTGTTGCTATAAAGG - Intronic
1124507316 15:30289571-30289593 TCTGTTTTGTGTTGCTATAAAGG - Intergenic
1124511108 15:30326648-30326670 TCCATTTTGTGTTCCCATAAAGG - Intergenic
1124571968 15:30872842-30872864 TCTGTTTTGTGTTGCTATAAAGG - Intergenic
1124601966 15:31140773-31140795 TCTGTTTAGTGTTGCTATAAAGG - Intronic
1124717392 15:32077622-32077644 TTCATTTAGTGTTCCTATAAAGG + Intronic
1124731806 15:32204117-32204139 TCCATTTTGTGTTCCCATAAAGG + Intergenic
1124736239 15:32249088-32249110 TCTGTTTTGTGTTGCTATAAAGG + Intergenic
1124793713 15:32754623-32754645 TCTCTTTTGTGTTGCTATAATGG - Intergenic
1125044652 15:35231628-35231650 TCTGTTTTGTGTTGCTATTAAGG + Intronic
1125776300 15:42217958-42217980 GCTGTTTATTTTTCCTAAAAGGG - Intronic
1125996498 15:44166269-44166291 TCTTTTTAGTGTTTATATAATGG + Intronic
1126073403 15:44885719-44885741 TCTACTTTGTGTTGCTATAAAGG + Intergenic
1126084542 15:44999553-44999575 TCTGTTTTGTGTTGCTATAAAGG - Intergenic
1126084862 15:45001906-45001928 TCTACTTTGTGTTGCTATAAAGG - Intergenic
1126252886 15:46589017-46589039 TCTATGTTGTGTTGCTATAAAGG + Intergenic
1126383744 15:48073487-48073509 TCTGTTTTGTGTTGCTATAAAGG + Intergenic
1126701601 15:51372795-51372817 TCTCTTTTGTGCTGCTATAATGG + Intronic
1126887611 15:53167646-53167668 CATGCTTAGTGTTCCAATAATGG + Intergenic
1127404788 15:58631253-58631275 TCTGTTTTGTGTTGTTATAAGGG - Intronic
1127500749 15:59551943-59551965 CATGCTTAGTGTTCCAATAATGG + Intergenic
1128002991 15:64211122-64211144 TCCATTTTGTGTTGCTATAAAGG - Intronic
1128397196 15:67240118-67240140 TATTTTTGGTGTTCCTAAAAGGG - Intronic
1128750575 15:70146074-70146096 TCTATTTTGTGTTGCTATAAAGG + Intergenic
1129012676 15:72436899-72436921 TCTGTTTTGTGTTGCAGTAAAGG - Intergenic
1129921946 15:79326824-79326846 TCTGCTTAGTGTTGCGATAAAGG + Intronic
1130026426 15:80274692-80274714 TCCATTTTGTGTTGCTATAAGGG - Intergenic
1130056305 15:80528873-80528895 TCTGTTTTGTCTTGCTATAAAGG - Intronic
1130173397 15:81541245-81541267 TTAGTTTAGTGTTGCTAAAAAGG - Intergenic
1131470211 15:92689956-92689978 TTTGTTTTGTGTTGCTATAAAGG - Intronic
1131619643 15:94054029-94054051 TCTGTTTATTGTTGTTATAAAGG - Intergenic
1131628017 15:94144807-94144829 TCCGTTTAGTGTTGCTATAAAGG - Intergenic
1131750471 15:95501693-95501715 TGTGTTTAATGATCCTTTAAGGG + Intergenic
1132682181 16:1147106-1147128 TCTGTTTCGTGTTGTTGTAAAGG + Intergenic
1132813436 16:1813413-1813435 TCTGTGTGGTGTTGCTATAAAGG - Intronic
1133068482 16:3228366-3228388 TTTGTTAAATGTTCTTATAAAGG + Intronic
1133661817 16:7925951-7925973 GCAGTGTAGTGTACCTATAATGG + Intergenic
1133664497 16:7952990-7953012 CATGCTTAGTGTTCCAATAATGG - Intergenic
1133863210 16:9616456-9616478 CATGCTTAGTGTTCCAATAATGG - Intergenic
1133878071 16:9753322-9753344 TCTGTTTTGCATTGCTATAAAGG - Intergenic
1134600531 16:15530197-15530219 CATGCTTAGTGTTCCAATAATGG - Intronic
1135097533 16:19577102-19577124 TTTGTTTAGTGGTACTATAAAGG + Intronic
1135250630 16:20898987-20899009 TCTGTTTAGTTTTGGTTTAAGGG - Intronic
1135476984 16:22785508-22785530 TCATTTTTGTGTTGCTATAAAGG + Intergenic
1135497015 16:22961742-22961764 TCTATTTAGTGTTGCTATAAAGG + Intergenic
1135497388 16:22964385-22964407 TCCGTCTAGTGTTGCTATAAAGG + Intergenic
1135670054 16:24367624-24367646 TCTGTTTTGTGTTGCTGTGAAGG - Intergenic
1135817921 16:25652856-25652878 TCTGTTTTATGTTGCTATAAAGG + Intergenic
1135913411 16:26581572-26581594 TCTCTTTTGTGTTGCTATCAAGG + Intergenic
1136099411 16:27982573-27982595 TCTATTTTGCGTTGCTATAAAGG + Intronic
1137367196 16:47870874-47870896 TCTGTTTTGTGTTGCTATGAAGG + Intergenic
1137527008 16:49245146-49245168 TCCATTTTGTGTTGCTATAAAGG - Intergenic
1138038604 16:53634843-53634865 TTTGTTTTGTGTTACTATAAAGG - Intronic
1138786465 16:59852248-59852270 TCCATGTAGTGTTGCTATAAAGG - Intergenic
1138894558 16:61187907-61187929 TCTTTTTTGTATTGCTATAAAGG + Intergenic
1138945938 16:61850050-61850072 TCCATTTTGTGTTGCTATAAAGG + Intronic
1138963246 16:62052197-62052219 TTAGTTTAGTGTTGCTACAAAGG - Intergenic
1138999685 16:62494515-62494537 TCTGTTTTGTGTTGCTATAAAGG - Intergenic
1139001155 16:62511808-62511830 TCTGTTTTGCGTTGCTAGAAAGG + Intergenic
1139022870 16:62773498-62773520 TCTGTTTTGTGTTGCCCTAAAGG + Intergenic
1139090436 16:63639954-63639976 TATGTTTTGTGTTGCCATAACGG + Intergenic
1139520843 16:67481847-67481869 TATGCTTAGCGTTCCAATAATGG - Intergenic
1139804434 16:69551997-69552019 TATGCTTAGCGTTCCAATAATGG - Intergenic
1140252666 16:73307905-73307927 TCTGTTCAGTGTTCCTGTAAAGG - Intergenic
1140323723 16:73979415-73979437 CATGCTTAGTGTTCCAATAATGG - Intergenic
1141024766 16:80535590-80535612 TCTGGTTTGTGTTGCTATAAAGG + Intergenic
1141295109 16:82760640-82760662 TCCCTTTTGTGTTGCTATAAAGG + Intronic
1143441172 17:6975419-6975441 TCTGCTTTGTGTTGCTATTAGGG - Intronic
1144000773 17:11052835-11052857 TCTATTTTGTGTTGCTATAAAGG + Intergenic
1144218941 17:13082732-13082754 TCTGTTTTGTGTTGCTATAAAGG + Intergenic
1144598791 17:16595242-16595264 TCTGTTTTGTGCTGCTATAATGG + Intergenic
1144667247 17:17110346-17110368 TCTGTTTTGTGCCGCTATAAGGG - Intronic
1144839367 17:18176162-18176184 TCTGTTTTACGTTGCTATAAAGG + Intronic
1144918715 17:18745866-18745888 TCTGTTTTGCTTTGCTATAAAGG + Intronic
1144925274 17:18801814-18801836 CATGCTTAGTGTTCCAATAATGG - Intronic
1145276145 17:21432047-21432069 TCTGTTATGTGTTGCTATAAAGG - Intergenic
1145277474 17:21441619-21441641 TCTGTTTCGTGTAGCTATAAAGG - Intergenic
1145313989 17:21717961-21717983 TCTGTTACTTGTTGCTATAAAGG - Intergenic
1145315311 17:21727514-21727536 TCTGTTTCGTGTAGCTATAAAGG - Intergenic
1145556931 17:24787990-24788012 TCTGTCTAGTTTTTCTATGAAGG - Intergenic
1145572102 17:25008484-25008506 TCTGTCTAGTTTTTCTATGAAGG - Intergenic
1145608831 17:25543270-25543292 TCTGTCTAGTTTTTCTATGAAGG - Intergenic
1145712435 17:26989938-26989960 TCTGTTATGTGCTCCTATAAAGG - Intergenic
1145713745 17:26999452-26999474 TCTGTTTTGTGTAGCTATAAAGG - Intergenic
1146296244 17:31652967-31652989 TCCATTTTGTGTTGCTATAAAGG + Intergenic
1146525838 17:33566309-33566331 TCCTTTTATTTTTCCTATAAAGG + Intronic
1146530032 17:33600687-33600709 CATGCTTAGTGTTCCAATAATGG + Intronic
1147061878 17:37886472-37886494 TCTGTTTTGTGTTGCTATAAAGG - Intergenic
1147890022 17:43710613-43710635 TCTGTTTTGTGCTGCTGTAATGG + Intergenic
1148627350 17:49079798-49079820 TCTGTTTTGTGTCACTATAGAGG + Intergenic
1149025238 17:52019167-52019189 TCTGTTTTGTGCTGCTATAAAGG - Intronic
1149469721 17:56906379-56906401 TCTGTTTTCTGCTGCTATAACGG - Intronic
1149882283 17:60305115-60305137 TCTGTTTTGCATTGCTATAAAGG + Intronic
1150550209 17:66203245-66203267 TCTATTTGGTGTTCCTGTGAGGG - Intergenic
1150732142 17:67704943-67704965 TCTATTTAGTGTTGCTATAAAGG + Intergenic
1150969325 17:70009823-70009845 ACTGTTTTGTGTTGCTATAAAGG - Intergenic
1151123361 17:71817888-71817910 TCTGTTTAGTGTTGCTATGAAGG - Intergenic
1151431199 17:74064470-74064492 TCTATTTCATGTTGCTATAAAGG - Intergenic
1153082816 18:1248187-1248209 TCTATTTTGTGTTGCTATAAAGG + Intergenic
1153091196 18:1345722-1345744 TCCGTTTGCTGTTGCTATAATGG - Intergenic
1153122162 18:1741750-1741772 TCTGTTTTTTGTTACCATAAAGG - Intergenic
1153212839 18:2786989-2787011 TCTGTTTTGTGTTGTTATAAAGG + Intronic
1153216405 18:2824964-2824986 TCTGTTTTGTGTTGCTTTAAAGG + Intergenic
1153216787 18:2828144-2828166 TCTGTTTTGTGTTGCTTTAAAGG + Intergenic
1153483930 18:5575920-5575942 TTTGTTTTGTGCTGCTATAAAGG - Intronic
1153654312 18:7269485-7269507 TCCATTTTGTGTTGCTATAAAGG + Intergenic
1153714150 18:7828814-7828836 TATATTTAGTGTTCTTGTAAAGG + Intronic
1153818448 18:8811056-8811078 TCCGTTTACTGTTGCAATAAAGG + Intronic
1153958615 18:10121018-10121040 TCCATTTAGTGTTGCTATAAAGG - Intergenic
1154039758 18:10842688-10842710 TCTGTTTAATGTTGCCATGAAGG - Intronic
1154470707 18:14697518-14697540 TCTGTTTTGTTTTCTTATTAGGG + Intergenic
1155099365 18:22593973-22593995 TCTGTTTTGTGTTGCTATAAGGG - Intergenic
1155420106 18:25646620-25646642 TCTATTTTGTGTTGCTATAAAGG - Intergenic
1155550550 18:26960589-26960611 TATGCTTAGCGTTCCAATAATGG - Intronic
1155735344 18:29215856-29215878 TCTGTTTTGTGTTGCTATAAAGG + Intergenic
1155795963 18:30036647-30036669 TCTGTTTTGCGTTACTATAAAGG + Intergenic
1155816949 18:30324213-30324235 TTTGTTTTGTGTTACTACAAAGG + Intergenic
1155835513 18:30578728-30578750 TCTGTTTTGTGTTGTTATAAAGG + Intergenic
1156050973 18:32933607-32933629 TCTGTTTTGTGCTGCTATAAAGG - Intergenic
1156356273 18:36343797-36343819 TCTGTTTTGTGTTGTTATAAAGG - Intronic
1156437392 18:37147219-37147241 TCTGTTTTGTGTTGCTATAAAGG - Intronic
1156549200 18:37997565-37997587 TCCATTTACTGTTCCTATAATGG - Intergenic
1157032360 18:43926974-43926996 TCTGTTTTGCGTTACTATAAAGG - Intergenic
1157365562 18:47061181-47061203 TCTGTTTTGCATTGCTATAAAGG + Intronic
1157623204 18:49027797-49027819 TCTGTTTCATGTTGCTATAAAGG + Intergenic
1157952724 18:52057726-52057748 TCCATTTTGTGTTGCTATAAAGG - Intergenic
1158290142 18:55931710-55931732 TCCATTTGGTGTTGCTATAAAGG - Intergenic
1158328699 18:56338001-56338023 TCTATTTACTGTTGCTATAAAGG - Intergenic
1158376279 18:56873066-56873088 ACTGATTAGTGTTTCTATAAGGG - Intronic
1158403511 18:57141403-57141425 TCCATTTTGTGTTGCTATAAAGG - Intergenic
1158767989 18:60478892-60478914 TCTATTTTGTGTTACTACAAAGG + Intergenic
1159101703 18:63965719-63965741 TCTGTTTTGTGTTGCTATATAGG + Intronic
1159420162 18:68208281-68208303 TCCATTTTGTGTTGCTATAAAGG + Intergenic
1159829295 18:73254554-73254576 TCCATTTGGTGTTGCTATAAAGG + Intronic
1160305291 18:77728397-77728419 TCCATGTAGTGTTGCTATAAAGG + Intergenic
1160576724 18:79859268-79859290 TCCATTCAGTGTTGCTATAAAGG + Intergenic
1161127932 19:2570364-2570386 TCTGTTTTGTGTTGCTATAAAGG - Intronic
1161452119 19:4352310-4352332 TATGCTTAGCGTTCCAATAATGG + Intronic
1163062477 19:14770454-14770476 TCTATGTTGTGTTGCTATAAAGG - Intronic
1163991008 19:20999288-20999310 TATGCTTAGTGTTCCAATAATGG - Intergenic
1164941011 19:32252323-32252345 TTTGTTTTGTGTTGCTATAAAGG - Intergenic
1165057329 19:33186098-33186120 CCTGTTTTGTGTTGCTGTAAAGG + Intronic
1165177490 19:33940838-33940860 TCCATTTTGTGTTGCTATAAAGG + Intergenic
1165191404 19:34066786-34066808 TCCATTTTGTGTTGCTATAAAGG - Intergenic
1165550640 19:36581874-36581896 TCTGTTTTGTGTTGCTATAAAGG - Intronic
1166021062 19:40030098-40030120 TTAGTTTTGTGTTGCTATAAAGG + Exonic
1166449683 19:42887699-42887721 TCAGTTTTGTGTTGCTAAAAAGG - Intronic
1167070301 19:47217978-47218000 TCTGTTTTGTCTTGCTGTAACGG + Intergenic
1168704101 19:58458589-58458611 TCTGTTTTGTGTCACTATAAAGG + Intergenic
925252140 2:2448728-2448750 TCCATTTAGTGTTGCTATAAAGG + Intergenic
925708199 2:6710729-6710751 TCTGTTTAGTGTTGCTATCAAGG - Intergenic
926381921 2:12299551-12299573 TCTGTTTTGTGTTCTTGTAAAGG + Intergenic
926524456 2:13959415-13959437 TTTGATTAGTGTTTCTATAGTGG + Intergenic
927084458 2:19660599-19660621 CCTGTTTGATGTTGCTATAATGG - Intergenic
927566949 2:24121959-24121981 TCTTTTTACTGTTGATATAAAGG - Intronic
928288257 2:30012305-30012327 TCCATTTAGTGTTGCTATAAAGG - Intergenic
928580770 2:32705366-32705388 TCTGTTTTGTGTTGCTGTAAAGG - Intronic
928600164 2:32896728-32896750 CATGCTTAGTGTTCCAATAATGG - Intergenic
928715827 2:34059145-34059167 CATGCTTAGCGTTCCTATAATGG - Intergenic
929025030 2:37592290-37592312 AATGTTTTGTGTTGCTATAAAGG - Intergenic
929135437 2:38619371-38619393 TCTGTTTTATGTTGCTGTAATGG - Intergenic
929407410 2:41658566-41658588 TCTGTTTTGTGTTGCTGTAAAGG - Intergenic
929518130 2:42623170-42623192 TTTGTTTAGTGTTCCAGTAATGG + Intronic
929804612 2:45133927-45133949 TCCATTTTGTGTTGCTATAATGG + Intergenic
929828270 2:45327576-45327598 TCTGTTTTGTGTTGCTCTAAGGG - Intergenic
930002826 2:46872708-46872730 GCTGTTTAGTGTTACTATAAAGG + Intergenic
930232833 2:48860096-48860118 TCCATTTTGTGTTGCTATAAAGG - Intergenic
930392114 2:50774416-50774438 ACTGTTTAGTGTTACTTTTAGGG - Intronic
930468849 2:51788464-51788486 TCTGTTTTCTGCTGCTATAATGG - Intergenic
931047063 2:58366379-58366401 TCTGGTTTCTCTTCCTATAAGGG - Intergenic
931459074 2:62434479-62434501 TCAGTTTTGAGTTCCTACAAAGG - Intergenic
932155106 2:69409508-69409530 TCTATTTAGTGTTGCTATAAAGG + Intronic
933165157 2:79067460-79067482 TCTGTTTTGTGTTTCTGTAAAGG - Intergenic
933235476 2:79859550-79859572 TCTGTTTAGGGCTTCTATACAGG + Intronic
934702070 2:96450512-96450534 TCTGTTTTATGTTGCTATAAAGG + Intergenic
935064256 2:99634245-99634267 TCTGTTTTCTCTTGCTATAAAGG - Intronic
935080945 2:99793391-99793413 TCTGTTTTGTGTTGCTGTAAAGG - Intronic
935496630 2:103789972-103789994 TCTGTTTAATGATCCTGTATTGG - Intergenic
935529109 2:104211282-104211304 TCTGTTTTGCATTGCTATAAAGG + Intergenic
935938968 2:108218537-108218559 ACTATTTAGTGTCACTATAAAGG - Intergenic
935995125 2:108762988-108763010 TAAGCTTAGTGTTCCAATAATGG - Intronic
936093545 2:109515641-109515663 TCTGTTTTGCGTTGCTACAAAGG + Intergenic
936665287 2:114587372-114587394 TCCATTTTGTGTTGCTATAAAGG - Intronic
936672322 2:114671553-114671575 TCAGTTTTGTGTTTCTATAAAGG - Intronic
936708661 2:115105241-115105263 TCTGTTTTGCATTGCTATAAAGG + Intronic
936723145 2:115278443-115278465 TCCATTTTGTGTTGCTATAAAGG + Intronic
936841625 2:116776376-116776398 TCTGTTTTGTGTTCTTAGCATGG - Intergenic
936845076 2:116821378-116821400 TCTATTTTGTGTTGCTATAAGGG + Intergenic
936989289 2:118345485-118345507 TCTGTTTTGTGTTGCTCTGAAGG - Intergenic
938118542 2:128618376-128618398 TCCATTTTGTGTTGCTATAAAGG - Intergenic
938152145 2:128896324-128896346 TCCATTTAGTGTTGCTATAAAGG - Intergenic
938370663 2:130766369-130766391 ACTGTTTTGTGTTGCTATAAAGG + Exonic
938469606 2:131546282-131546304 CATGCTTAGTGTTCCAATAATGG - Intergenic
938861709 2:135376037-135376059 TCTGACCAGTGTCCCTATAAGGG + Intronic
938900209 2:135793021-135793043 TCTGTTATGAGTTGCTATAATGG - Intronic
939196053 2:138974031-138974053 TCTGTTTTGTGTTGCTAAAAAGG + Intergenic
939259108 2:139783997-139784019 TCTGTTTTGCATTCCTATAAAGG + Intergenic
939888296 2:147705636-147705658 TCCATTTTGTGTTGCTATAAAGG + Intergenic
940156374 2:150661115-150661137 TTTGTTTAGTATTGCTATAAAGG - Intergenic
940260356 2:151772871-151772893 TCTGCTTTGTGTTCCTAGCATGG + Intergenic
940828978 2:158446547-158446569 TTTATTAAGTGTTCATATAAGGG + Intronic
940941091 2:159561491-159561513 TCTATTTTGTGTTGCTCTAAAGG - Intronic
941198917 2:162484994-162485016 TCTGTTTCGTGTGGCTCTAAAGG - Intronic
941248532 2:163132079-163132101 TCCATTTAGTGCTGCTATAATGG - Intergenic
941314263 2:163972983-163973005 TCTGGCTGCTGTTCCTATAAAGG + Intergenic
941872706 2:170402223-170402245 TATGCTTTGTGTTCCAATAATGG + Intronic
941966576 2:171306378-171306400 TCCGTTTTGTGTTGCTGTAACGG - Intergenic
942106209 2:172636171-172636193 TCTGTTTTGCTTTGCTATAAAGG + Intergenic
942390912 2:175492241-175492263 TATGTTTTGTGTTGCTATGAAGG + Intergenic
942437094 2:175990509-175990531 TCTGTTTAGTGTTGCTATAAAGG - Intronic
942524834 2:176842012-176842034 TCTGTTTTGTGCTGCTGTAAAGG - Intergenic
942675259 2:178420441-178420463 TTTGTTTAGTGTTGCTTTAAAGG + Intergenic
942892667 2:181011152-181011174 TCTGTTTTGTGTTGTTGTAATGG + Intronic
942903796 2:181156729-181156751 TCTGTTTTGTGTTGTTATAAAGG + Intergenic
942982073 2:182094779-182094801 CATGCTTAGTGTTCCAATAATGG + Intronic
943150120 2:184100662-184100684 TCCATTTTGTGTTGCTATAAAGG - Intergenic
943705022 2:191025469-191025491 TCTGTGTTGTGTTACTCTAAAGG - Intergenic
943986201 2:194622343-194622365 GTTGTTTAGTGTTGTTATAAAGG - Intergenic
944514227 2:200495905-200495927 CATGCTTAGTGTTCCAATAATGG - Intronic
944766187 2:202866463-202866485 TCCATTTTGTGTTACTATAAAGG - Intronic
944791399 2:203131586-203131608 AATGCTTAGTGTTCCAATAATGG - Intronic
944917847 2:204378969-204378991 TCTGTTTAATGTTGCTAAAAAGG - Intergenic
944977066 2:205065901-205065923 TCCATTTTGTGTTCCTATAATGG - Intronic
945590335 2:211721124-211721146 TTTGTTTAGTGTTCCCAAGAGGG - Intronic
945668374 2:212770626-212770648 TCCATTTAGTATTGCTATAAAGG - Intergenic
946107129 2:217380893-217380915 TCTGTTTTGTGTCACTATAAAGG + Intronic
946464255 2:219897328-219897350 TCTATTTTGTGTTGCTGTAAAGG + Intergenic
946663263 2:222023325-222023347 CGTGCTTAGTGTTCCAATAATGG - Intergenic
946709968 2:222495615-222495637 TCTTTTTTGTGTTCCAAGAAAGG + Intronic
947109944 2:226707865-226707887 TCTGGTCAGTGCTCCTACAAGGG + Intergenic
947147671 2:227083292-227083314 TCTGTATAGTGTTTCTATAATGG - Intronic
947929071 2:233948370-233948392 CATGCTTAGTGTTCCAATAATGG - Intronic
948102465 2:235385687-235385709 TATGCTCAGTGTTCCAATAATGG - Intergenic
948518355 2:238520229-238520251 TCTGTTGGGTGTTGCTAGAATGG - Intergenic
948536602 2:238651683-238651705 TCTGTTTTGTGTTGCTACAAAGG + Intergenic
1169500050 20:6150827-6150849 TTCATTTAGTGTTGCTATAAAGG + Intergenic
1169637942 20:7715548-7715570 CCTGCTTAGCGTTCCAATAATGG - Intergenic
1169995735 20:11554199-11554221 TGTCTTTTGAGTTCCTATAATGG - Intergenic
1170081542 20:12482176-12482198 TCTGTTTTGTGTTGCTATAAAGG - Intergenic
1170311380 20:14996480-14996502 TCAGTTTTGTGTTCCTGCAAGGG - Intronic
1170318793 20:15070808-15070830 TCTGTTTTGAGTTGCCATAAAGG - Intronic
1170481017 20:16764853-16764875 TCTGTTTAGTGTTCCTATAAAGG - Intronic
1170712665 20:18806442-18806464 TCTGTTTTGTGTTGCTATGAAGG - Intergenic
1170988355 20:21279325-21279347 TCTGTTTAGAGTTGCTATAAAGG + Intergenic
1171353360 20:24522660-24522682 TCCGTTTTGTGTTGCTGTAAGGG + Intronic
1171740834 20:28885276-28885298 TCTGTTTAGTTTTCATGTGAAGG + Intergenic
1171911720 20:30967449-30967471 TCTGTGTAGTTTTTATATAAAGG + Intergenic
1172098418 20:32471999-32472021 TCCGTTTGGTGTTGCTATAAAGG - Intronic
1172911334 20:38411413-38411435 TCTGTTCTGCATTCCTATAAAGG + Intergenic
1173560577 20:44002570-44002592 TCTGTTTTGCATTGCTATAAAGG + Intronic
1173590784 20:44222978-44223000 TCTGTTTTGCGATGCTATAAAGG - Intergenic
1173709723 20:45144007-45144029 TATATTTGGTGTTCCTATAGGGG + Intergenic
1174786520 20:53438023-53438045 TCTGTTTTGCGTTGCTATAAGGG - Intronic
1176322511 21:5346499-5346521 TCTGTGTAGTTTTCATATGAAGG - Intergenic
1176338822 21:5623855-5623877 TCTGTTGACTCATCCTATAAGGG + Intergenic
1176340230 21:5686928-5686950 TCTGTTGACTCATCCTATAAGGG + Intergenic
1176472484 21:7119081-7119103 TCTGTTGACTCATCCTATAAGGG + Intergenic
1176480164 21:7278119-7278141 TCTGTGTAGTTTTCATATGAAGG - Intergenic
1176496045 21:7500859-7500881 TCTGTTGACTCATCCTATAAGGG + Intergenic
1176504597 21:7637528-7637550 TCTGTTGACTCATCCTATAAGGG - Intergenic
1176734461 21:10531534-10531556 TCTGTTTAGTGTTGCCATAAGGG - Intronic
1176803778 21:13460410-13460432 TCTGTTTTGTTTTCTTATTAGGG - Intergenic
1176923655 21:14720366-14720388 TCTGTCTTGTGTTCATATAGAGG - Intergenic
1176958443 21:15132612-15132634 TCAGTTTTGTATTGCTATAAAGG - Intergenic
1176985540 21:15431666-15431688 TGTGTTTTGTGTTGCTATAAAGG + Intergenic
1177101910 21:16908431-16908453 TATGTCTAGTGTTCCTCTAGTGG - Intergenic
1177176748 21:17707985-17708007 CATGCTTAGTGTTCCAATAATGG - Intergenic
1177297998 21:19202160-19202182 TCAATTTGGTGTTCCTACAAGGG - Intergenic
1177376400 21:20275530-20275552 TCTGCTTAGTGCCCTTATAAAGG + Intergenic
1177387542 21:20427345-20427367 TCTGTTTTGTGTTGCTAAAAGGG + Intergenic
1177517488 21:22174588-22174610 TCCATTTTGTGTTGCTATAAAGG - Intergenic
1177618261 21:23554476-23554498 TCTGTTTTGTCTTCCTATAATGG - Intergenic
1178396717 21:32249594-32249616 TCCATTTTGTGTTGCTATAAAGG + Intergenic
1178472439 21:32905431-32905453 TCCATTTTGTGTTGCTATAAAGG + Intergenic
1178631623 21:34265984-34266006 TCTGTTCAGTGTTGCTATAAAGG - Intergenic
1179326564 21:40352118-40352140 CATGCTTAGTGTTCCAATAATGG + Intronic
1179335795 21:40451794-40451816 CATGTTTAGTGTTCCAATAATGG - Intronic
1179341390 21:40513368-40513390 TCTGTTTGGTGCTGCTGTAAGGG + Intronic
1179492206 21:41747931-41747953 TATGATTAGCGTTCCAATAAGGG + Intronic
1180114063 21:45684784-45684806 TCTGTTTTGCGTTGCTATAAAGG - Intronic
1180461329 22:15567875-15567897 TCTATTTAGTGGTTCTAAAATGG + Intergenic
1180562204 22:16627010-16627032 TCTGTTTAGTGTTGCCATAAGGG - Intergenic
1180919396 22:19512787-19512809 TCCATTTTGTGTTGCTATAAAGG + Intronic
1181852033 22:25756232-25756254 TCTGCTTTGTGTTGCTATAAAGG - Intronic
1181890502 22:26058885-26058907 TCCATTTAGTGTTGCTATAAAGG - Intergenic
1182201697 22:28578526-28578548 TCAGTTTGGTGTTCCTGTAGTGG - Intronic
1182206283 22:28630623-28630645 TCTGTTTTGTGTGGCTATAAAGG - Intronic
1182456650 22:30455996-30456018 TCCATTTTGTGTTACTATAAAGG + Intronic
1182873699 22:33671751-33671773 CATGCTTAGTGTTCCAATAATGG - Intronic
1182921273 22:34081997-34082019 TTTGTTTTGTGTTGCTATGAGGG + Intergenic
1182961780 22:34482101-34482123 TCAGTTTTGTGTTGCTAGAAAGG - Intergenic
1183136003 22:35888479-35888501 TCCATTTAATGTTGCTATAAAGG + Intronic
1183497056 22:38152676-38152698 TCTGTTTAGTGTTGCTATAAAGG - Intronic
1183555088 22:38519433-38519455 TCTGTTTTCTGTTGCTATAAAGG + Exonic
1183643345 22:39106665-39106687 TCTGGTTAGTTTTACTTTAAGGG - Intergenic
1183837658 22:40469549-40469571 TCTGTTTTGGGTTGCTAAAAGGG - Intronic
1184365273 22:44047111-44047133 TCTATTTCGTGTTGCTATAAAGG + Intronic
1203239495 22_KI270733v1_random:1386-1408 TCTGTTGACTCATCCTATAAGGG + Intergenic
949093648 3:60204-60226 TTTATTTTGTGTTGCTATAAAGG - Intergenic
949724943 3:7033423-7033445 TCTGTTTTGTGTTGCTATTTAGG + Intronic
949749359 3:7333059-7333081 TCTGTTATGAGTTGCTATAATGG - Intronic
950332491 3:12167638-12167660 TCTGTTTTGTGTTGCTATAAAGG - Intronic
950801962 3:15559855-15559877 TCTGTTTAGTGTTGCTATAAAGG + Intergenic
950826992 3:15833777-15833799 CATGCTTAGTGTTCCAATAATGG + Intronic
951548395 3:23852210-23852232 TCCATTTTGTGTTGCTATAAAGG - Intronic
951975865 3:28507955-28507977 TTCATTTAGTGTTGCTATAAAGG + Intronic
952188517 3:30997179-30997201 CATGATTAGTGTTCCAATAATGG + Intergenic
952473563 3:33682149-33682171 TCTGTTTTGTGTTGCTGTAAAGG - Intronic
952670512 3:35961747-35961769 TCTGTTTTGCATTGCTATAAAGG + Intergenic
953281833 3:41565726-41565748 TCTGTTTTCTGTTGCTATAACGG - Intronic
953693335 3:45138499-45138521 TTCGTTTTGTGTTGCTATAAAGG + Intronic
954528401 3:51295118-51295140 TCCATTTTGTGTTTCTATAAAGG + Intronic
954948821 3:54450754-54450776 TTCCTTTAGTGTTGCTATAAAGG - Intronic
955101751 3:55856954-55856976 TCTGTATGGTTTTCCTATACTGG - Intronic
955104348 3:55882399-55882421 TCCATTTAGTGTTGCTATAAAGG - Intronic
955171417 3:56569242-56569264 TCTGTTTTGTGTTGCTATAAAGG + Intronic
955385834 3:58479112-58479134 TCTGTGTAGTGTTCCTATAAAGG + Intergenic
955597857 3:60611383-60611405 CATGCTTAGCGTTCCTATAATGG - Intronic
955856857 3:63281613-63281635 TGGGATTAGTGTTCTTATAAGGG - Intronic
956133388 3:66075271-66075293 TCTGTTTTGTGTTGCTATAAAGG - Intergenic
956317842 3:67958869-67958891 CATGTTTAGTGTTCCAATAATGG - Intergenic
956326089 3:68054517-68054539 TCTATTTTGTATTGCTATAAAGG - Intronic
956334614 3:68149352-68149374 TCTATTTTGTGTTGCTATACAGG + Intronic
956379683 3:68652626-68652648 TCCATTTAGTGTTGCTGTAAAGG - Intergenic
956629090 3:71297056-71297078 TCTGTTTGGTGTTGCTATAAAGG - Intronic
956868665 3:73394688-73394710 TTTGTTTAGAGTTCCTAAGAAGG - Intronic
956930029 3:74033255-74033277 TCCATTTTGTGTTGCTATAAAGG + Intergenic
957011635 3:75012308-75012330 TCTGTTTTGCATTGCTATAAAGG - Intergenic
957336622 3:78838383-78838405 TTTGTTTTGTGTTGCTATAAAGG + Intronic
957928037 3:86840267-86840289 TCCGTTATGTGTTGCTATAAAGG - Intergenic
957977060 3:87460359-87460381 TCAATTTAGTGTTCATGTAAGGG - Intergenic
958011866 3:87889281-87889303 TCTGTTTAGTGTTGCTATAAAGG - Intergenic
958036079 3:88172012-88172034 TCTGTGTTGTGTTACTATAAAGG + Intergenic
958217370 3:90605011-90605033 TCTGTCTAGTTTTTCTATGAAGG + Intergenic
958217410 3:90605859-90605881 TCTGTCTAGTTTTTCTATGAAGG + Intergenic
958220150 3:90660281-90660303 TCTGTCTAGTTTTTCTATGAAGG + Intergenic
958445464 3:94209678-94209700 TCCCTTTGGTGTTGCTATAAAGG + Intergenic
958500220 3:94896350-94896372 TCTCTTTTGTTTTCCTAAAAAGG + Intergenic
959108843 3:102097400-102097422 CTTGTTTAGTGTTGCTGTAAAGG - Intergenic
959161536 3:102730741-102730763 TCTGTTTTGCTTTGCTATAAAGG + Intergenic
959655595 3:108800738-108800760 TCTGTTTTGTGTTGCTATAAAGG - Intergenic
959805212 3:110543135-110543157 TCTGTTTTCTGTTGCTATAATGG - Intergenic
960524353 3:118692362-118692384 TCCATTTAGTGTTGCTATAAAGG - Intergenic
960650067 3:119937526-119937548 TCAGTTTAGTGCTGCTATAAAGG - Intronic
961913140 3:130342178-130342200 ACTGTTTACTTTTCCTATTATGG + Intergenic
961970059 3:130953939-130953961 TCTGACCAGTGTTCCCATAAAGG - Exonic
962387829 3:134946929-134946951 TCCATTTTGTGTTGCTATAAAGG - Intronic
962473575 3:135736138-135736160 TCTATTTTGCGTTGCTATAAAGG - Intergenic
962587809 3:136860462-136860484 TCCCTTTAGTGTTGCTAGAAAGG + Intergenic
962712510 3:138099912-138099934 TAAGTTTAGTGTTGCAATAAAGG - Intronic
964098205 3:152958405-152958427 TTTGTGTAGTGTTGTTATAACGG - Intergenic
964565348 3:158044824-158044846 TCTGTTTTGAATTGCTATAAAGG + Intergenic
965235489 3:166114591-166114613 TCTGTTCTGTGTTACTATAAAGG + Intergenic
965581963 3:170278345-170278367 TCTGTTTTGTGTTGTTACAAAGG + Intronic
965844368 3:172945375-172945397 TCAGTTTGGTGTTCCCATGAGGG - Intronic
965904202 3:173682758-173682780 CATGCTTAGTGTTCCAATAATGG + Intronic
966026562 3:175290701-175290723 CATGCTTAGTGTTCCAATAATGG + Intronic
966029385 3:175326555-175326577 TCCATTTTGTGTTGCTATAATGG + Intronic
966071767 3:175886483-175886505 CATGTTTAGTGTTCCAATAAAGG - Intergenic
966400367 3:179541557-179541579 TCTATTTTGTGCTGCTATAAAGG + Intergenic
967578326 3:191123588-191123610 TCTTTTAAGTGTTACAATAATGG + Intergenic
967651952 3:191996530-191996552 TCCATTCAGTGTTGCTATAAAGG - Intergenic
967675849 3:192298402-192298424 TCCATTTTGTGTTGCTATAAAGG + Intronic
970061789 4:12041939-12041961 CATGCTTAGTGTTCCAATAATGG + Intergenic
970497471 4:16641388-16641410 TCTGTTTTGCTTTGCTATAAAGG + Intronic
971175778 4:24281222-24281244 TCTGTTTTGTGTTGCTATGTAGG + Intergenic
971524790 4:27603548-27603570 TCTGTTTTGCATTTCTATAACGG + Intergenic
971536070 4:27752962-27752984 TCCATTTTGTGTTGCTATAACGG - Intergenic
971662131 4:29432432-29432454 TCTGTTTTATGTTGCTATAAAGG - Intergenic
971729085 4:30353104-30353126 TCTGCTTTGTGTTGCTGTAAAGG - Intergenic
971823505 4:31591021-31591043 TCTGTTTGGCATTGCTATAAAGG + Intergenic
972163001 4:36247771-36247793 TCTCTTAAGTTTTCTTATAAAGG - Intergenic
972254856 4:37342451-37342473 TCTGTTCTGTGTTGCTATAAAGG - Intronic
972300318 4:37779385-37779407 TCCATTTTGTGTTTCTATAAAGG - Intergenic
972878284 4:43393107-43393129 TCTGTTTAGTGTCGTTATATAGG + Intergenic
972930158 4:44062651-44062673 TCTCTTTTGTATTGCTATAAAGG - Intergenic
972944028 4:44231029-44231051 TTTGTTTAGTGTTCCTCCACTGG + Intronic
973072301 4:45878087-45878109 CATGCTTAGTGTTCCAATAATGG + Intergenic
973259995 4:48153556-48153578 ACAGCTTAGTGTTCCAATAATGG - Intronic
973276519 4:48315569-48315591 TGTGTTGTGTGTTGCTATAAAGG - Intergenic
973595476 4:52484304-52484326 TCTGTTTTGTGCTGCTATCATGG - Intergenic
973739486 4:53905350-53905372 ACTGTCTCGTGTGCCTATAAGGG + Intronic
974192297 4:58521542-58521564 TCTGTTTTGTGTTGCTGTACAGG - Intergenic
974372941 4:61041483-61041505 TCTCTTTAGTGTTGTTATAAAGG + Intergenic
974421278 4:61679009-61679031 TCTGTTTTGTGTTGCTATAAAGG + Intronic
974467634 4:62277585-62277607 TCTGTTTAATCTTCCTACTAAGG - Intergenic
974734384 4:65910968-65910990 TCTGTTTCCTGTTGCTGTAATGG + Intergenic
974869035 4:67615439-67615461 TTGGTTTTGTGTTGCTATAAAGG - Exonic
975248533 4:72149414-72149436 TCCATTTAGTGTTGCTATAACGG - Intergenic
975394276 4:73856810-73856832 TCTGTTTTGCATTGCTATAATGG + Intergenic
976775383 4:88700391-88700413 TCTGTTTAGTGTTGCTAAAAAGG + Intronic
976794465 4:88917111-88917133 TCTGTTTTGTGTTGCTATAAAGG + Intronic
976821188 4:89208905-89208927 TCTGTTTTGTGTTGTTATGAAGG + Intergenic
977399273 4:96510763-96510785 TCTGTATAGTCTTCCCAAAAAGG + Intergenic
977604163 4:98965175-98965197 CCTGTTTAGTGTTGCTATAAAGG - Intergenic
977623281 4:99162204-99162226 TCTGTTTTGTGCTGCTATAATGG + Intergenic
978583683 4:110256477-110256499 TCCCTTTAGTGTTGCTGTAAAGG + Intergenic
979497817 4:121404478-121404500 TCTGCTCAGTGTTGCTATAAAGG + Intergenic
979784757 4:124701984-124702006 TATGTCTACTGTTCATATAAAGG + Intronic
980212922 4:129813599-129813621 TCTGTTTAGTATTGCTATAAAGG + Intergenic
980312619 4:131152947-131152969 TCTGTGTAGTTTTCTTATACAGG + Intergenic
980480597 4:133382192-133382214 TCTGTGTAGTTCTACTATAAAGG + Intergenic
980653733 4:135755545-135755567 TCTGTTTTGTGTTGCTATGAAGG + Intergenic
981180185 4:141732537-141732559 TATGTTTATTTTTCCAATAATGG - Intronic
981735370 4:147944599-147944621 TCTTTTTAGTGTTTTTAAAAAGG + Intronic
981821075 4:148888220-148888242 TCCATTTTGTGTTGCTATAAAGG + Intergenic
981909287 4:149959451-149959473 TGTGATTAGTGTCCTTATAAAGG + Intergenic
982411122 4:155078380-155078402 TCTGTTTTGCATTGCTATAAAGG - Intergenic
982503001 4:156182539-156182561 TTTGTTTAGTGTTCTTTTACTGG + Intergenic
982523186 4:156445500-156445522 TATGCTTAGCGTTCCAATAATGG + Intergenic
982534299 4:156589386-156589408 TCCATTTAGTGTTGCTGTAAAGG - Intergenic
982560206 4:156920217-156920239 TATGTTTTGTGTTGCTATAAAGG - Intronic
982580174 4:157167697-157167719 TCCGTTTTGTGCTGCTATAAAGG + Intronic
982617512 4:157658906-157658928 TGAGATTAGTGTTCCTACAAAGG - Intergenic
982775902 4:159441103-159441125 TCTGTTTTGTGTTGCTGTAAAGG - Intergenic
983270292 4:165553133-165553155 TCATTTTAATGTTTCTATAAAGG + Intergenic
983353336 4:166622864-166622886 TCTGTTTTGCATTGCTATAAAGG + Intergenic
983692227 4:170484025-170484047 TGTGCCTGGTGTTCCTATAAAGG + Intergenic
983984609 4:174043194-174043216 GCTGTTTAGTGGACCTCTAAGGG - Intergenic
984042876 4:174758185-174758207 TCTGTTTTGCATTGCTATAAAGG - Intronic
984147710 4:176084142-176084164 TCTGTTTTGTGTTGCTATAAAGG + Intronic
984215583 4:176909810-176909832 TCTGTTTAGTGTTGCTATACAGG - Intergenic
984438522 4:179734963-179734985 TCTTTTTACTGTTTATATAAAGG + Intergenic
984882453 4:184422220-184422242 TCTGTTTCATGTTGCTACAAAGG - Intronic
985309050 4:188577391-188577413 TCTGTTTTGCATTGCTATAAAGG + Intergenic
985357126 4:189133225-189133247 TTTGTTTTGTATTGCTATAAAGG - Intergenic
985906086 5:2838184-2838206 TCCATTTTGTGTTGCTATAAAGG + Intergenic
986425394 5:7626466-7626488 TCTGCTTAGTGCTGCTATAAAGG + Intronic
986741912 5:10712104-10712126 TATGATTGGTGTCCCTATAAGGG + Intronic
986964644 5:13255957-13255979 TTTGTTTTGTGCTGCTATAATGG + Intergenic
987459440 5:18190617-18190639 TCCATTTTGTGTTGCTATAAAGG + Intergenic
987536696 5:19198857-19198879 TCAGTTTTGTGTTGCTATCAAGG + Intergenic
987571701 5:19671516-19671538 TCTGTTTAGAGTTCCAAATATGG + Intronic
987762902 5:22188442-22188464 TCTGTTTTGTGTTGCTCTAAAGG - Intronic
988127200 5:27055518-27055540 TCTGTTTTGTGTTGCTATAAAGG - Intronic
988228363 5:28443590-28443612 TATGTTTCCTGATCCTATAAAGG + Intergenic
988463629 5:31465952-31465974 TCTGTTTTGCATTCCTCTAAAGG - Intronic
988580987 5:32468740-32468762 TCTGCTCAGTCTTCCTCTAAAGG - Intergenic
988724493 5:33912604-33912626 TCTGTTTTGTGTTTTCATAAAGG + Intergenic
989277378 5:39605196-39605218 TCTGTTTTGTGTTGTCATAATGG + Intergenic
989640108 5:43575993-43576015 TCTGTTTTGTGTTGCTATAAAGG - Intergenic
990434349 5:55772892-55772914 TTTGTTTTGTGTTGTTATAAAGG - Intronic
991317633 5:65327321-65327343 TCTGTTTTGTGTTGCTCTAAAGG - Intronic
991554229 5:67877202-67877224 TACGTTTAGTGTTGCTATAAAGG - Intergenic
991600548 5:68347906-68347928 TCCATTTTGTGTTGCTATAAAGG - Intergenic
991897688 5:71421840-71421862 TCTGTTTTGTGTTGCTCTAAAGG - Intergenic
991972075 5:72150990-72151012 TCCATTTTGTGTTGCTATAAAGG + Intronic
992000394 5:72430558-72430580 TCCATTTTGTGTTGCTATAAAGG - Intergenic
992128286 5:73665505-73665527 TCTGTTTTGTGCTGCTCTAATGG + Intronic
992192492 5:74307275-74307297 TCTATTTTGTGTTGCTATAGAGG - Intergenic
992426115 5:76659274-76659296 TCTCTTTTGTATTCATATAAAGG - Intronic
992647394 5:78824236-78824258 TCTGTTTTGCGTTGCTGTAAAGG - Intronic
992951264 5:81860246-81860268 CATGCTTAGTGTTCCAATAATGG - Intergenic
992988723 5:82260887-82260909 TCTATTTTGTGCTGCTATAATGG - Intronic
993346833 5:86794510-86794532 TCTATTTAGTTTCACTATAAAGG - Intergenic
993446588 5:88020264-88020286 TCTGTTTTGCGTTGCTAAAAAGG + Intergenic
993741385 5:91545038-91545060 TCCATTTTGTGTTGCTATAATGG + Intergenic
994083989 5:95738745-95738767 TCCGTTTTGTGCTTCTATAATGG - Intronic
994859002 5:105163619-105163641 TCCATTTTGTGTTTCTATAAGGG + Intergenic
994944816 5:106373766-106373788 TATGCTTAGTGTTCCAATAATGG + Intergenic
995152762 5:108869059-108869081 TAAGTTTAGTGTTCCAATAATGG + Intronic
995541387 5:113189600-113189622 TCTGTATCGTGTGACTATAAAGG - Intronic
995626317 5:114080638-114080660 TATGTTTAGTGTTTTTATCATGG - Intergenic
995781108 5:115776228-115776250 TCTGCCTAGTCTTCCTATGATGG - Intergenic
996552572 5:124745725-124745747 TCTGTTTTTTGTTCCTAGTAAGG + Intronic
996662566 5:126021451-126021473 TCTGTTCTGTGTTCCTATAAAGG - Intergenic
996723468 5:126652593-126652615 TATATTTAGTCTTTCTATAAAGG - Intergenic
996783733 5:127215857-127215879 TCTGCTTTGTGTCACTATAAAGG - Intergenic
997148552 5:131465936-131465958 TTTGTTTTGTTTTCCTCTAAAGG - Intronic
997227519 5:132220296-132220318 TCTGTTTCTTGTTCCTCAAAAGG + Intronic
997308895 5:132863223-132863245 TCTGATAAGTGTTTCTATTATGG - Intronic
997399709 5:133592925-133592947 CCCATTTAGTGTTGCTATAAAGG - Intronic
997804903 5:136907111-136907133 TCCATTTTGTGTTGCTATAAAGG - Intergenic
998210108 5:140189506-140189528 TCTGTTTTGTGTTGCTATAAAGG - Intronic
998452098 5:142242619-142242641 TCCATTTTGTATTCCTATAAAGG - Intergenic
998722095 5:144964518-144964540 CCTTTTTATTGTTTCTATAATGG - Intergenic
998851792 5:146358215-146358237 TCCATTTAGTGTTGCCATAAAGG + Intergenic
999599989 5:153252215-153252237 TCCATTTAGTGTTGCTATAAAGG + Intergenic
1000422558 5:161055256-161055278 TCCATTTTGTGTTGCTATAAAGG + Intergenic
1000509333 5:162162806-162162828 TCCATTTTGTGTTGCTATAAAGG - Intergenic
1000763256 5:165252753-165252775 TCTTTTTTCTGTTCCTATGAAGG - Intergenic
1000799382 5:165705396-165705418 TCTCTTTTGTGTTGCTATAAAGG - Intergenic
1001613233 5:173020984-173021006 TTTGTTTTGTGTTGCTATAAAGG + Intronic
1001946186 5:175780091-175780113 TCCATTTTGTGTTGCTATAAAGG - Intergenic
1002446010 5:179290454-179290476 TCTATTTTGTGTTGCTATAATGG - Intronic
1002788423 6:421293-421315 TCTGTTGCCTGTTGCTATAATGG + Intergenic
1003077367 6:2994419-2994441 TCTGTTTTGTGTTGCTATAAAGG - Intronic
1003509174 6:6765104-6765126 TCTGTTTTGTGTTGCTATAAAGG - Intergenic
1003788889 6:9520316-9520338 TCTGTTTTGCATTGCTATAAAGG + Intergenic
1003953632 6:11142063-11142085 TCTGTTTTGTATTGCTATAAAGG - Intergenic
1004244398 6:13959167-13959189 TCTGTTTTGTGTTGCTATAAAGG - Intronic
1004478092 6:15992962-15992984 TCTGTTTTGCATTGCTATAAAGG - Intergenic
1005220768 6:23585574-23585596 TCCATTTTGTGTTTCTATAAAGG - Intergenic
1005222677 6:23605974-23605996 TCTGTTTTGTGTTGCTCTAACGG + Intergenic
1005433320 6:25781487-25781509 TCGCTTTTGTGTTGCTATAAAGG + Intergenic
1006484451 6:34327168-34327190 TCTGTTTCGGCTACCTATAAGGG - Intronic
1006960927 6:37929078-37929100 CATGCTTAGTGTTCCAATAATGG - Intronic
1007342192 6:41198351-41198373 TCTGTGCAGTGCTCCTATAAGGG - Exonic
1008271333 6:49494000-49494022 TATGTTTAGTGTTGCTATAAAGG - Intergenic
1008271557 6:49495832-49495854 TCTCTTTAGTGTTGCCATAAAGG - Intergenic
1008627457 6:53331797-53331819 TCCGTTTGGTGTTGCTATAAAGG + Intronic
1008639319 6:53445225-53445247 TCTGTTTTGTGTTGCTATAAAGG - Intergenic
1008777514 6:55059094-55059116 TCTATTTTGTGTTGCTATAAAGG - Intergenic
1009736624 6:67684751-67684773 CATGCTTAGTGTTCCAATAATGG - Intergenic
1009786541 6:68347518-68347540 TCTGTTTTGTGTTGCTATAAAGG - Intergenic
1009812060 6:68680913-68680935 TCTATTTTGTGTTGTTATAAAGG + Intronic
1009831292 6:68939318-68939340 CATGCTTAGTGTTCCAATAATGG + Intronic
1010003343 6:70970180-70970202 TTTGTTTTGTGTTGCTATAAAGG + Intergenic
1010018614 6:71134579-71134601 TCGGTTTGGTGTTCCTGTAGTGG - Intergenic
1010022684 6:71178984-71179006 TCTATTTTGTGTTGCTGTAAAGG - Intergenic
1010024898 6:71203939-71203961 TCTGTTTTGAGTTGCTATAAAGG + Intergenic
1010064196 6:71661965-71661987 TCTGTTCATTGTTCATATATTGG - Intergenic
1010516922 6:76784534-76784556 TCTGTTTTGTGTTGCTACAAAGG - Intergenic
1010555013 6:77267944-77267966 TTTGTTTTCTGTTTCTATAAAGG - Intergenic
1010561994 6:77362205-77362227 TCTATTTTGTTTTGCTATAAAGG - Intergenic
1010590528 6:77706943-77706965 TCTGTTTTGTATCACTATAAAGG - Intronic
1010974753 6:82299181-82299203 CCTGTTTTGTATTGCTATAAAGG + Intergenic
1011323344 6:86121471-86121493 TCCATTTTGTGTTGCTATAAAGG - Intergenic
1011329898 6:86192525-86192547 ACTGTTTTGTGTTGCTATAAAGG - Intergenic
1011780840 6:90787681-90787703 TATCTTTAGGGTTCTTATAATGG + Intergenic
1011793827 6:90930855-90930877 TCTTTTTGGTGTTCTAATAAAGG + Intergenic
1011801274 6:91018923-91018945 TCTGTTGTCTCTTCCTATAAGGG + Intergenic
1012091052 6:94897726-94897748 TCTATTTTGTGTTGCTATAAAGG + Intergenic
1012124949 6:95417308-95417330 TCTGTTTTGTGTTGCTATAAAGG - Intergenic
1012191906 6:96289742-96289764 TCTGATAAGTTTTCCTTTAATGG - Intergenic
1012397672 6:98818639-98818661 TCTGTTTTGCATTGCTATAAAGG + Intergenic
1012649972 6:101740588-101740610 TCTGTTTTGTGTTTTTATAAAGG + Intronic
1012859222 6:104539744-104539766 TCTGTTTTGTGTTGCTATAACGG + Intergenic
1012974897 6:105769656-105769678 TCCATTTAGTGTTGCTATAAGGG - Intergenic
1013425053 6:110004013-110004035 TTTGTTTTGTGTTGCTCTAAAGG - Intergenic
1013729663 6:113149553-113149575 TCAGTTTCATGTTGCTATAAAGG - Intergenic
1014099005 6:117489053-117489075 TCTGTTCTGTGTTGCTGTAAGGG + Intronic
1014266577 6:119284906-119284928 TCTGTTTTGTGTCGCTATAAAGG + Intronic
1014806087 6:125831322-125831344 TCATTTTAGTGTACCTATAGTGG + Intronic
1015171428 6:130259175-130259197 TCTGTTTTATGCTGCTATAAAGG + Intronic
1015620459 6:135126686-135126708 TCTGTTTTGAGTTGCTATAATGG - Intergenic
1015821377 6:137264594-137264616 TCTGTTTTCTGCTGCTATAACGG - Intergenic
1015821557 6:137266705-137266727 TCTGTTTTGTGTTGCTATAAAGG + Intergenic
1015877053 6:137833486-137833508 TATGTTTTGTGTTACTATAAAGG + Intergenic
1016085446 6:139907825-139907847 TCTGTTTAGTGTTGCTATAAAGG - Intergenic
1016836548 6:148483068-148483090 TCTATTTAGTGTTGCTATAAAGG + Intronic
1017037706 6:150281289-150281311 TTCATTTAGTGTTGCTATAAAGG - Intergenic
1017326725 6:153149638-153149660 TCTGTTTTGCATTGCTATAAAGG + Intergenic
1017594698 6:156015844-156015866 TCTGTTGTGTGTTGCTATAAAGG - Intergenic
1018028752 6:159825786-159825808 ACTGTTTTGTGTTCCACTAAGGG + Intergenic
1018032619 6:159854210-159854232 TCTGTTTGGTGTTCTTAACATGG - Intergenic
1018515003 6:164569875-164569897 TCTGTTCTGTGTTGCTATAAGGG + Intergenic
1018593656 6:165454746-165454768 TTTGTTTTGTGTTGCTATACCGG - Intronic
1018620062 6:165721614-165721636 TCTGTTGATTTTTCCTACAAAGG - Intronic
1018766352 6:166936380-166936402 TCTGTCTAGTGTCGCTATACAGG + Intronic
1019887467 7:3918046-3918068 TCTGTTTTGTCTACCTAGAAGGG - Intronic
1020380435 7:7539140-7539162 TCCATTTTGTGTTGCTATAAAGG + Intergenic
1020776434 7:12459896-12459918 TATGCTTAGTGTTCCGATAATGG + Intergenic
1020945958 7:14606997-14607019 CATGCTTAGTGTTCCAATAATGG + Intronic
1021161164 7:17274472-17274494 TCTATTCTGTGTTGCTATAATGG - Intergenic
1021546756 7:21822110-21822132 TCTGTTTTGCATTGCTATAAAGG + Intronic
1021804485 7:24341659-24341681 TCCCTTTAGTGTTGCTACAAAGG + Intergenic
1021985685 7:26096376-26096398 TCTGTGTAGTGTTTCTAAAGAGG - Intergenic
1022151805 7:27615958-27615980 ACCATTTAGTGTTGCTATAAAGG + Intronic
1022486567 7:30783471-30783493 CATGCTTAGTGTTCCAATAATGG - Intronic
1023110235 7:36802838-36802860 GCTGTTTAATGTTTCTATTAGGG - Intergenic
1023192147 7:37594152-37594174 CCCGTTTTGTGTTCCTATACGGG - Intergenic
1023215577 7:37859135-37859157 TCTGTTTTGTGTTGTTATCAAGG - Intronic
1023813159 7:43927931-43927953 TCTGTTTTGTGTTGCTATAAAGG + Intronic
1024346175 7:48316584-48316606 TTTATTTGGTGTTGCTATAAAGG + Intronic
1024450559 7:49537231-49537253 CATGCTTAGTGTTCCAATAAAGG - Intergenic
1024616315 7:51116724-51116746 TCTGTTAAGTGTTTCTTTTATGG + Intronic
1025104497 7:56160066-56160088 TCTATTTTGTGTTGCTATAAAGG + Intergenic
1025537132 7:61963022-61963044 TCTGTATAGTGTTTATATGAAGG - Intergenic
1025571389 7:62575321-62575343 TCTGTCTAGTTTTCATATGAAGG + Intergenic
1025862091 7:65339701-65339723 TCAATTTGGTGTTCCTATATGGG + Intergenic
1026135356 7:67656023-67656045 TCTGTGTTGTGTTGCTATACAGG - Intergenic
1026277323 7:68891517-68891539 TCCATTTTGTGTTCCTATAAAGG + Intergenic
1026313233 7:69206531-69206553 TCTATTTTGTGTTGTTATAAAGG + Intergenic
1026449406 7:70514288-70514310 TCTGTTTTGCATTGCTATAAAGG + Intronic
1026554134 7:71391425-71391447 TCCCTTTTGTGTTGCTATAAAGG + Intronic
1026560422 7:71444036-71444058 TCCATTTTGTGTTGCTATAAAGG - Intronic
1026639693 7:72113487-72113509 TCTGTTTTGTGTTGCTATAAAGG - Intronic
1026672171 7:72400117-72400139 TCCGTTTTGTGCTGCTATAAAGG - Intronic
1026769433 7:73185489-73185511 TATGTATCGTGTTCCTAAAATGG + Intergenic
1027010302 7:74738873-74738895 TATGTATCGTGTTCCTAAAATGG + Intronic
1027077740 7:75207164-75207186 TATGTATCGTGTTCCTAAAATGG - Intergenic
1027294629 7:76756104-76756126 TCCATTTAGTGTTGCTATAAAGG - Intergenic
1027493861 7:78863248-78863270 TCTGTTTAGTGTTGCTATAAAGG + Intronic
1027525525 7:79264647-79264669 TCTGTTTTCTGTTGCTATAAAGG + Intronic
1027664259 7:81024511-81024533 TGTGTTTAGTAATCCTATAATGG + Intergenic
1028174121 7:87633854-87633876 CCTGTTTTGTGTTGCTATAAAGG + Intronic
1028315291 7:89393908-89393930 TCTATTTAGCGTTTCTATAAAGG - Intergenic
1028457134 7:91050654-91050676 TCTCATTTGTGTTGCTATAAAGG + Intronic
1029115490 7:98234493-98234515 TCCATTTTGTGTTGCTATAAGGG - Intronic
1029269164 7:99366479-99366501 TCTGTTTTGTGTTGCAATAAAGG + Intronic
1029591297 7:101508819-101508841 TTCGTTTTGTGTTGCTATAAAGG + Intronic
1029970874 7:104787840-104787862 TGGGATTAGTGTTCTTATAAAGG - Intronic
1030044327 7:105481489-105481511 CATGCTTAGTGTTCCAATAATGG + Intronic
1030200698 7:106900709-106900731 TATATTTAGTGTTCCTTTCAAGG + Intronic
1030424321 7:109354326-109354348 TTTGTTTTGTGTTGCTATAAAGG - Intergenic
1030515399 7:110532436-110532458 TCTGTTTTGTGTTGCAGTAAAGG + Intergenic
1030840407 7:114345570-114345592 TTTCTTTAGTGTTCCTAGTATGG + Intronic
1030946790 7:115733311-115733333 TTTGTTTAACTTTCCTATAATGG + Intergenic
1031348329 7:120696881-120696903 TCTATTTTGTGTTGCTGTAATGG - Intronic
1031506949 7:122596807-122596829 TGGGTTTTGTGTTGCTATAAAGG - Intronic
1032267484 7:130379667-130379689 TCTGGTTACTGTTCCCATGAAGG + Intergenic
1032985571 7:137333342-137333364 TCTGTTTTGTGTTGCTATAAAGG - Intronic
1033064224 7:138138241-138138263 TCTGTTTTGTATTGCTATGAAGG + Intergenic
1033242400 7:139690903-139690925 TCCCTTTAGTGTTGCTATCAAGG - Intronic
1033594394 7:142845915-142845937 TCTGTTCTGTGTCACTATAAAGG - Intergenic
1033812571 7:145033487-145033509 TCTGTTTTGTGTTACTATAAAGG + Intergenic
1034106841 7:148497525-148497547 TCTGTTTTGTGTTGTTATAAAGG - Intergenic
1034145479 7:148867376-148867398 TCTGTTTTGTGCTGGTATAACGG - Intronic
1034173975 7:149086184-149086206 TCTGTTTAGTATTGCTGTAAAGG + Intronic
1034200134 7:149279079-149279101 TCTGTCTAGTGTTCCTCTGCGGG + Intronic
1034756859 7:153630325-153630347 TTTGCTTAGCGTTCCAATAATGG - Intergenic
1034878439 7:154745527-154745549 TCTGTTTTGTGTTGCCATAAAGG + Intronic
1035147076 7:156829617-156829639 TCTGTTATGTGTTGCTATAAAGG - Intronic
1035178675 7:157073423-157073445 TCTGTTTTGTGTTGCTATGAAGG + Intergenic
1036156256 8:6345173-6345195 TCTGTTTTGTTTTCACATAATGG + Intergenic
1037234493 8:16702199-16702221 TCCATTTTGTGTTGCTATAAAGG + Intergenic
1037236689 8:16728490-16728512 TCTGCTTAGTGGTGCTATAAAGG - Intergenic
1037447973 8:18986921-18986943 TATGCTTAGTGTTCCATTAATGG + Intronic
1037468562 8:19184848-19184870 CATTTTTAGTGTTCCAATAATGG - Intergenic
1037844681 8:22272664-22272686 TCCCTTTAGTGTTACTATAAAGG - Intergenic
1037964283 8:23121313-23121335 CATGTTTAGTGTTCCAATAATGG - Intergenic
1038318809 8:26510379-26510401 TCTATTTTGTGTTGCTATAAAGG - Intronic
1038541993 8:28397533-28397555 TCTGTTTTGTGTTGTTGTAAAGG - Intronic
1038750614 8:30292037-30292059 TCTGTTAAGTGTTGCTATATAGG + Intergenic
1038920526 8:32078465-32078487 CCTGTTTTGTGTTGCTATAAAGG - Intronic
1039158830 8:34594665-34594687 TCTGTTTTGCATTACTATAAAGG + Intergenic
1039491371 8:37950039-37950061 TCTATTTAGTGTTGCCATAAAGG - Intergenic
1039491948 8:37954379-37954401 TCTGTTTCATTTTGCTATAAAGG - Intergenic
1039681083 8:39737230-39737252 TTTGTTTTGTGTTGCTATAAAGG + Intergenic
1040013489 8:42681667-42681689 TCTGTTTTGTATTGCTATAAGGG + Intergenic
1040143466 8:43957478-43957500 TCTGTGTAGTTTTTCTATGAAGG - Intergenic
1040272169 8:45964706-45964728 TCTGTGTAGTTTTTCTATGAAGG - Intergenic
1040462403 8:47661521-47661543 TCTGATTAATGTTCATAAAACGG - Intronic
1040529759 8:48257155-48257177 TCCATTTTGTGTTGCTATAAAGG + Intergenic
1040586808 8:48751038-48751060 TCTGTTTTGTGTTGCTGTAACGG - Intergenic
1040904917 8:52457977-52457999 CCTTTTTAGTGTTACTATAAAGG - Intronic
1040914872 8:52558802-52558824 TCCGTTTTGTGTGGCTATAAAGG + Intronic
1041306178 8:56463668-56463690 TCTGTTTTGTGCTTTTATAAAGG - Intergenic
1041902677 8:62999144-62999166 TCTGTTTTGTATTGTTATAAAGG + Intronic
1042490201 8:69389114-69389136 TCTACTTAGTGTTCATGTAATGG + Intergenic
1042631326 8:70820297-70820319 TCTGTTTTGCATTGCTATAAAGG + Intergenic
1042649148 8:71020892-71020914 TCTGTTTAGTGTTGCTATAAAGG + Intergenic
1043134239 8:76500942-76500964 TCAATTTAGTGTTCCTGTAGAGG + Intergenic
1043360914 8:79471062-79471084 TTTGTTTTGTATTGCTATAAAGG + Intergenic
1043639642 8:82435685-82435707 TATGTTTTGTGTTGCTATAAAGG - Intergenic
1043652563 8:82614668-82614690 TCTGTTTAGGATTTCTACAAAGG - Intergenic
1043963440 8:86444887-86444909 TCTGTTTTGTGTTGCTGTAAGGG + Intronic
1044459865 8:92430896-92430918 TCATTTTTGTGTTACTATAAAGG - Intergenic
1044622623 8:94205036-94205058 CATGCTTAGTGTTCCAATAATGG + Intronic
1044752502 8:95429958-95429980 TCTGTTTTATGTTTCTATAAAGG - Intergenic
1044806689 8:96015789-96015811 TCTGTTTTGTGTTGCTATAAAGG - Intergenic
1044886211 8:96781222-96781244 TCTATTTTGTGCTGCTATAACGG + Intronic
1044925670 8:97206713-97206735 TCTGTTTTCTGCTGCTATAACGG + Intergenic
1045038983 8:98202741-98202763 TCCATTTTGTGTTGCTATAAAGG - Intronic
1045066385 8:98450070-98450092 TCCATTTTGTGTTGCTATAATGG - Intronic
1045800526 8:106096168-106096190 TCAGTTTAGTGTTCCTGCAGTGG - Intergenic
1045830967 8:106459469-106459491 TCTGCTTTGTATTGCTATAATGG - Intronic
1045878574 8:107011512-107011534 TCTCTTTTGTGTTGCTATAAAGG - Intergenic
1046600508 8:116311823-116311845 TCTGTCTACTGTTCCTTTATTGG - Intergenic
1046652173 8:116848136-116848158 TCTGTTTTGTGTTGCTCTAAAGG - Intronic
1047081199 8:121462758-121462780 CCTGTTTAGTGTTGCTATGAAGG - Intergenic
1047173486 8:122517638-122517660 TCTGATTTGTGTTGCTATAAAGG - Intergenic
1047218614 8:122900137-122900159 TCCATTTTGTGTTGCTATAAAGG + Intronic
1047813306 8:128434138-128434160 GCAGTTTTGTGTTGCTATAAAGG - Intergenic
1048516416 8:135115748-135115770 TCTGGTTAGTGTTGCTCTAAAGG + Intergenic
1049336319 8:142088542-142088564 CATGCTTAGTGTTCCAATAATGG - Intergenic
1050074710 9:1851707-1851729 TCTGTTTTGTGTAGCTGTAAAGG - Intergenic
1050128062 9:2380020-2380042 TCTTTTTTGTGTCACTATAAAGG - Intergenic
1051598674 9:18850404-18850426 TGTGTTTGGTGGTGCTATAATGG + Intronic
1053172935 9:35903957-35903979 CATGCTTAGTGTTCCAATAATGG - Intergenic
1055131081 9:72775660-72775682 TCCATTTCGTGTTGCTATAAAGG + Intronic
1055163585 9:73162918-73162940 TCCATTTTGTGTTGCTATAAGGG + Intronic
1055171512 9:73265067-73265089 TTTGTTTAGTGTTGTGATAACGG - Intergenic
1055315973 9:75034938-75034960 TCTTTCTAGGGATCCTATAATGG + Intergenic
1055494929 9:76844531-76844553 TCTGTTTTGTGTTGCTGTAAAGG - Intronic
1055820226 9:80253317-80253339 CCTGTTTTGTGTTGCTATAAAGG + Intergenic
1056046395 9:82722062-82722084 TCCATTTTGTGTTGCTATAAAGG + Intergenic
1056113667 9:83421280-83421302 TCTGGTTCCTGTTGCTATAAAGG - Intronic
1056189038 9:84166803-84166825 TCTGTTTTGTGTTATTATAAAGG + Intergenic
1056397946 9:86198487-86198509 TCCATTTTGTGTTGCTATAAAGG - Intergenic
1057092029 9:92266918-92266940 TCTGTTTAGTGTAGCTACAAAGG - Intronic
1057643045 9:96845965-96845987 TCTGTTAAGTTTTCCTTTATAGG - Intronic
1058012750 9:99996498-99996520 TTTGTTTTGTCTTGCTATAAAGG - Intronic
1058341653 9:103904736-103904758 TTTCTTTAGTGTTGCTATAAAGG - Intergenic
1058910396 9:109515536-109515558 TCCATTTTGTGTTGCTATAAAGG + Intergenic
1059170825 9:112123106-112123128 TCAGTTTCATGTTGCTATAAAGG + Intronic
1059552200 9:115240409-115240431 TCTGTTTAGTCTTCATATCAAGG + Intronic
1059897145 9:118878988-118879010 TCTGTTTTGTGTTGCTATAAAGG + Intergenic
1060572599 9:124656335-124656357 TCCCTTTAGTGTTGCTGTAAAGG - Intronic
1060777453 9:126385953-126385975 TCTGTTTAGTGGTAGTATATGGG - Intronic
1060833766 9:126739421-126739443 TCCGTTTTGTGTTGTTATAAAGG - Intergenic
1061650766 9:132047952-132047974 CATGCTTAGTGTTCCAATAATGG - Intronic
1203422837 Un_GL000195v1:11065-11087 TCTGTTGACTCATCCTATAAGGG - Intergenic
1203684030 Un_KI270757v1:23548-23570 TCTGTTTAGTTTTCATGTGAAGG - Intergenic
1185525546 X:775587-775609 TATGCCTAGTGTTCCAATAATGG - Intergenic
1185596757 X:1311784-1311806 TCTGTTTTGTGTTGCTACAAAGG - Intergenic
1185687226 X:1939272-1939294 TCTGTTTTGTGTTTCTATGAAGG - Intergenic
1185922691 X:4111875-4111897 TCCGTTTTGTGTTGCTATAAAGG + Intergenic
1186000348 X:5002308-5002330 TCTGCTTTGTGTTGCTATAAAGG - Intergenic
1186051469 X:5600480-5600502 CATGCTTAGTGTTCCAATAATGG - Intergenic
1186642938 X:11475082-11475104 TCTGTTTTGTGTTGTGATAAAGG - Intronic
1186656442 X:11616666-11616688 TCTGTTTTGTGTTGCTATGAAGG - Intronic
1186833784 X:13417571-13417593 TCTGTTTTGCATTGCTATAAAGG - Intergenic
1186845977 X:13531727-13531749 TCTTTTTTGTGTTGCTATAAAGG + Intergenic
1186920304 X:14271220-14271242 TCTGTTTTGTGTTGCTATAAGGG - Intergenic
1187104314 X:16224301-16224323 TCCATTTAGTGTTGCTATAAAGG + Intergenic
1187686826 X:21824116-21824138 TCCATTTTGTGTTGCTATAAAGG + Intergenic
1187775401 X:22751055-22751077 TCTGTTTTGCATTGCTATAAAGG + Intergenic
1187794536 X:22987759-22987781 TCTCTTTAGTTTGCCTATAATGG + Intergenic
1187948846 X:24452518-24452540 TCCATTTAGTGTTGCTATTAAGG + Intergenic
1188050441 X:25478721-25478743 TTTGTTTTGTGTTGCTATAAAGG - Intergenic
1188103853 X:26124554-26124576 TCGGTTTTGTGTTGCTATAAAGG - Intergenic
1188351733 X:29139916-29139938 TCAATTTTGTGTTGCTATAAAGG + Intronic
1188713352 X:33429587-33429609 TCCATTTAGTGTTGCTATAAAGG - Intergenic
1188888517 X:35581340-35581362 TCTATTTTGTGTTGTTATAAAGG - Intergenic
1189127187 X:38461116-38461138 TCTGTGTAGTGTTGCTATGAAGG + Intronic
1189201079 X:39196127-39196149 TACGTTTCGTGTTGCTATAAAGG + Intergenic
1189374393 X:40455394-40455416 TCCGTTTTGTGTTGCTATAAAGG + Intergenic
1189426965 X:40910372-40910394 TCTGTTTTGTGTTGTTATAAAGG + Intergenic
1189432695 X:40961755-40961777 CATGCTTAGTGTTCCAATAATGG - Intergenic
1189640126 X:43060023-43060045 TTGGTTTAGTGCTGCTATAAAGG + Intergenic
1189858728 X:45250705-45250727 TGTGTTTAATGCTGCTATAAAGG + Intergenic
1190032334 X:46986211-46986233 TTTATTTAGTATTGCTATAAAGG - Intronic
1190170108 X:48105587-48105609 TTTGTTTTCTGTTACTATAATGG - Intergenic
1190188025 X:48252943-48252965 TTTGTTTTCTGTTACTATAATGG - Intronic
1190512710 X:51190948-51190970 TCTGTTTTGTGTTGCTCTAAAGG + Intergenic
1190536995 X:51439175-51439197 TCCATTTAGTATTGCTATAAGGG + Intergenic
1190643919 X:52506953-52506975 TCCATTTTGTGTTGCTATAAAGG - Intergenic
1190656908 X:52620706-52620728 TTTGTTTTCTGTTGCTATAATGG - Intergenic
1191842988 X:65526252-65526274 TCTGTTTAGTGTTGCTATAAAGG - Intronic
1192024029 X:67429028-67429050 TCTGTTTTGCATTGCTATAAAGG + Intergenic
1192056352 X:67777711-67777733 TCCATTTTGTGTTGCTATAAAGG + Intergenic
1192130157 X:68542365-68542387 TCTGTTTTGTTTTGCTATGACGG + Intergenic
1192274032 X:69611757-69611779 TCTATTTTGTGTTGCTATAAAGG - Intergenic
1192481521 X:71490331-71490353 TTTGTTTTGTGCTGCTATAACGG - Intronic
1192677938 X:73219390-73219412 TCAGTTTAATGTTCCCATAGGGG - Intergenic
1193592287 X:83404646-83404668 TCTGTTTCAGGTTGCTATAAAGG - Intergenic
1193627191 X:83836411-83836433 TCTATTTGGTGCTGCTATAAAGG + Intergenic
1193949849 X:87784363-87784385 CCCATTTAGTGTTGCTATAAAGG + Intergenic
1194632995 X:96309784-96309806 TCTTTTTACTGTCCCTATAAGGG - Intergenic
1194737332 X:97528325-97528347 TCTGTTTAGTGTTGCTATAAAGG + Intronic
1194767352 X:97857053-97857075 TCTGTTTGGTGTTGCTAAAAAGG + Intergenic
1194825061 X:98551312-98551334 TCTATTTAGTGTTGCTATAAAGG - Intergenic
1194853091 X:98892761-98892783 TCTGTTTTGTGTTGCTATAAAGG - Intergenic
1194878072 X:99214346-99214368 TTTTTTTAGTGTTACTATAAAGG - Intergenic
1195233926 X:102878372-102878394 TCCATTTAGTGTTGCTATAAAGG + Intergenic
1195556025 X:106225246-106225268 TTTGTTTACTGTTGCTATAAAGG - Intergenic
1195785737 X:108520138-108520160 TCTGTTTAGGTTTGATATAATGG + Intronic
1196164429 X:112522920-112522942 TCTGTTTTGTGTTGCTATAAAGG + Intergenic
1196261102 X:113582769-113582791 TCCCTTTTGTGTTGCTATAAAGG + Intergenic
1196376118 X:115034381-115034403 TCTGTTTTGTGTTGCTATAAAGG - Intergenic
1197182588 X:123552234-123552256 TCTGTTTAGTGTAGCTCTATCGG - Intergenic
1197397948 X:125950482-125950504 TCTGTTTTGTATTGCTATAAAGG - Intergenic
1197866337 X:131022561-131022583 TCTATTTTGTGTTGCTATAAAGG - Intergenic
1197973682 X:132141787-132141809 TTTATTTTGTGTTGCTATAAAGG - Intergenic
1198175550 X:134151018-134151040 TTAGTTTAGTGTTGCTGTAATGG + Intergenic
1198790520 X:140340309-140340331 TCTGTTTTGTGTGGCTATAAAGG - Intergenic
1198861519 X:141075652-141075674 TCTGTTTTGTGTTGCTAAAAAGG - Intergenic
1198901173 X:141511731-141511753 TCTGTTTTGTGTTGCTAAAAAGG + Intergenic
1199048442 X:143206051-143206073 TCCATTTCGTGTTGCTATAAAGG + Intergenic
1199372546 X:147068317-147068339 TCCCTTTTGTGTTGCTATAAAGG + Intergenic
1199479756 X:148285333-148285355 TCCATTTTGTGTTGCTATAAAGG + Intergenic
1200055688 X:153459117-153459139 TTTGCTTTGTGTTCCTCTAATGG + Intronic
1200344925 X:155438577-155438599 TCCATTTAGTGTTACTATAAAGG - Intergenic
1200382177 X:155849445-155849467 TCTATTTTCTGTTGCTATAAAGG - Intergenic
1200815707 Y:7530023-7530045 TATGCTTAGCGTTCCAATAATGG + Intergenic
1201527666 Y:14954268-14954290 TCTGATTGGTGTACCTAAAAGGG + Intergenic
1202592489 Y:26501039-26501061 TCTGTTTCGTGTTGCCATAAGGG - Intergenic