ID: 1170481019

View in Genome Browser
Species Human (GRCh38)
Location 20:16764882-16764904
Sequence CACTACCCACTAGTGGAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 60}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170481014_1170481019 22 Left 1170481014 20:16764837-16764859 CCTAGCCTCAAGTATTCCTTTAT 0: 36
1: 475
2: 1507
3: 4176
4: 10926
Right 1170481019 20:16764882-16764904 CACTACCCACTAGTGGAACTTGG 0: 1
1: 0
2: 0
3: 1
4: 60
1170481017_1170481019 6 Left 1170481017 20:16764853-16764875 CCTTTATAGGAACACTAAACAGA 0: 1
1: 15
2: 94
3: 275
4: 709
Right 1170481019 20:16764882-16764904 CACTACCCACTAGTGGAACTTGG 0: 1
1: 0
2: 0
3: 1
4: 60
1170481016_1170481019 17 Left 1170481016 20:16764842-16764864 CCTCAAGTATTCCTTTATAGGAA 0: 2
1: 52
2: 552
3: 1267
4: 1717
Right 1170481019 20:16764882-16764904 CACTACCCACTAGTGGAACTTGG 0: 1
1: 0
2: 0
3: 1
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170481019 Original CRISPR CACTACCCACTAGTGGAACT TGG Intronic
902536669 1:17122904-17122926 AACTACCGTCTACTGGAACTTGG - Intergenic
904490655 1:30857040-30857062 CACTCCCCAGTGGTGGAAGTAGG + Intergenic
916173042 1:162015611-162015633 CACTTCCCAATATTGGACCTTGG + Intronic
923448486 1:234094594-234094616 GTCTAACCATTAGTGGAACTAGG + Intronic
1064340409 10:14480463-14480485 AGCTACCCAATAGGGGAACTCGG + Intergenic
1065035815 10:21637793-21637815 CACTACACACTGATGGTACTTGG - Intronic
1067069674 10:43122408-43122430 CCCCACCCACAAGTGGAGCTTGG + Intronic
1073747239 10:106483050-106483072 CACTACCCACTATTAGCATTTGG - Intergenic
1075979239 10:126722665-126722687 CACCACCCCCTAGTGCAGCTGGG - Intergenic
1076112701 10:127873074-127873096 CACTTCCCAGTAGTAGACCTTGG - Intergenic
1089378192 11:118009986-118010008 CAGTAGCCAGTTGTGGAACTTGG + Intergenic
1094339803 12:29398392-29398414 CACTACTTAATGGTGGAACTGGG + Intergenic
1094483618 12:30905751-30905773 CATCCCCCACTAGGGGAACTTGG + Intergenic
1097005735 12:55916451-55916473 CCATACCCTCTAGTGAAACTGGG - Intronic
1110582400 13:77145931-77145953 TACTACCTACTAGTGAAAATAGG - Intronic
1111275522 13:85940506-85940528 AGCTACCTACTAATGGAACTAGG - Intergenic
1119774258 14:77238821-77238843 CACTACCCACTTGAGGACCCAGG - Intronic
1120324519 14:83008113-83008135 CAGTACACACTAGTGTAATTGGG - Intergenic
1122777615 14:104128646-104128668 CACTGCCAAGAAGTGGAACTTGG - Intergenic
1123787863 15:23690550-23690572 CACTTCCCACTAGAGGCTCTGGG - Intergenic
1127159655 15:56168661-56168683 CCCTACCTGCAAGTGGAACTAGG - Intronic
1128907948 15:71485042-71485064 CACTAGCCTCTAGAGGAGCTGGG - Intronic
1129868287 15:78925253-78925275 CACACCCCACTCGTGGGACTTGG - Intronic
1158279707 18:55810595-55810617 CACTGCCCAAAAATGGAACTAGG - Intergenic
1164731643 19:30509905-30509927 CACTACCCACCACAGGAACATGG - Intronic
935403367 2:102683408-102683430 CAAGAACCACGAGTGGAACTGGG + Exonic
938954508 2:136285445-136285467 CCCTCCCCTCTAGTGGTACTTGG + Intergenic
943337762 2:186639577-186639599 CACTTCCCAATAGTGGAAGGAGG - Intronic
944678878 2:202057996-202058018 CACTACCAACTGATTGAACTTGG + Intergenic
946073556 2:217054765-217054787 CATTAACCCCTAGTGGATCTTGG - Intergenic
947781782 2:232772823-232772845 CACTACAGACTTGTGGAGCTAGG + Intronic
1168801610 20:647011-647033 CACTGCCCTCTAAGGGAACTTGG - Exonic
1170481019 20:16764882-16764904 CACTACCCACTAGTGGAACTTGG + Intronic
1174955303 20:55091213-55091235 CCCTGCCAACTATTGGAACTTGG - Intergenic
1184192603 22:42904809-42904831 CAGTCCCCACTAGTGGAATGTGG + Intronic
950885287 3:16357276-16357298 AGCTACCCACTAGTGAATCTTGG + Intronic
969279815 4:6162181-6162203 CACTGCCCTCTAGTGGGACGAGG - Intronic
985893574 5:2735811-2735833 CACCAGCAACTAGTGGAGCTTGG + Intergenic
989470264 5:41808625-41808647 CTCTACCCAGTAGTTCAACTTGG - Intronic
993902068 5:93591324-93591346 CACAACCCCCTAGTTGATCTGGG + Intronic
994224033 5:97231219-97231241 CACTGCCCCCTAGAGGAACAAGG - Intergenic
999089232 5:148920926-148920948 CTCTTCCCACTAGCAGAACTGGG + Intergenic
1003689725 6:8341340-8341362 CACTACCCAGTAGTGGCTCTTGG - Intergenic
1012992143 6:105936937-105936959 AGCTACCAACTGGTGGAACTGGG - Intergenic
1020819078 7:12943253-12943275 TAATACCCACATGTGGAACTGGG + Intergenic
1021566886 7:22024938-22024960 CACTGCCCAACAGTGCAACTGGG + Intergenic
1022185356 7:27961963-27961985 TACTCACCACTAGTGGAGCTGGG - Intronic
1028460583 7:91087460-91087482 CACAGCTCAGTAGTGGAACTAGG - Intronic
1029962709 7:104705791-104705813 CATTCCCCACTACCGGAACTGGG + Intronic
1030082848 7:105792220-105792242 CACTTCCCTCTAGGGAAACTAGG - Intronic
1048562949 8:135562179-135562201 CACTTACCATGAGTGGAACTTGG - Intronic
1050346227 9:4690935-4690957 CACTCTCCACTGATGGAACTTGG - Intronic
1050952107 9:11610661-11610683 TACTACCACCTAGTGCAACTTGG + Intergenic
1052743582 9:32417102-32417124 CACTAGTCAGTGGTGGAACTGGG - Intronic
1058317217 9:103583078-103583100 CAGTAACCACTAGTAAAACTAGG + Intergenic
1060068673 9:120527356-120527378 CACTACCCACATGTGGCTCTTGG + Intronic
1062174305 9:135152527-135152549 CACCCCCCACAAGAGGAACTAGG + Intergenic
1189719905 X:43905420-43905442 TGCTACCAACTGGTGGAACTTGG - Intergenic
1189864808 X:45316173-45316195 CACTAACCACTAGTAAAATTTGG - Intergenic
1189954972 X:46268633-46268655 CTCTACCAGATAGTGGAACTTGG - Intergenic
1190862739 X:54359109-54359131 CACTACCAGCTAGAGGATCTGGG - Intergenic
1200136901 X:153879660-153879682 CCCTGCCCACTTGTGGCACTGGG + Intronic