ID: 1170481337

View in Genome Browser
Species Human (GRCh38)
Location 20:16768050-16768072
Sequence TGGCATGAGGTCTTTCCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 175}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170481332_1170481337 29 Left 1170481332 20:16767998-16768020 CCAACAAACATTAAAGGCAAAGC 0: 1
1: 0
2: 3
3: 23
4: 276
Right 1170481337 20:16768050-16768072 TGGCATGAGGTCTTTCCTTGTGG 0: 1
1: 0
2: 1
3: 12
4: 175
1170481335_1170481337 -9 Left 1170481335 20:16768036-16768058 CCTCTATCTAGATCTGGCATGAG 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1170481337 20:16768050-16768072 TGGCATGAGGTCTTTCCTTGTGG 0: 1
1: 0
2: 1
3: 12
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170481337 Original CRISPR TGGCATGAGGTCTTTCCTTG TGG Intronic
900564389 1:3325178-3325200 AGGCATGAGAGATTTCCTTGGGG - Intronic
900801727 1:4741229-4741251 TGGTCTGTGGTCCTTCCTTGCGG - Intronic
910018483 1:82555897-82555919 TGGCAGGATGGCTTTCCTTTAGG - Intergenic
910064308 1:83135049-83135071 TGGCTTGACATCTTTCCTTTAGG + Intergenic
916721341 1:167486707-167486729 TGGCCAGAGCTCTTTCCTGGGGG - Intronic
917533894 1:175860875-175860897 TGGCAAGAGGCCCTTCCCTGTGG + Intergenic
917835155 1:178935888-178935910 TGGCAAGAGTCCATTCCTTGAGG - Intergenic
1062972005 10:1655120-1655142 CTGCATGGGGCCTTTCCTTGAGG + Intronic
1064073834 10:12252907-12252929 TGGCATTTGTTCTTTCTTTGAGG + Intergenic
1066251114 10:33633688-33633710 TTGCATGATGTTTTTCCTTCTGG + Intergenic
1070472033 10:76790253-76790275 TGGCATGAGATATCTCATTGTGG + Intergenic
1071100168 10:82027667-82027689 TGGCATCAGGTCTTGCCATCAGG + Intronic
1074225825 10:111483478-111483500 GGGCATCAGGCCCTTCCTTGGGG - Intergenic
1076425849 10:130367129-130367151 GGCCATGAGGTCTTCCCTTGTGG + Intergenic
1076625070 10:131816566-131816588 CGGGAATAGGTCTTTCCTTGAGG + Intergenic
1077910057 11:6565689-6565711 TCTCATGAGGCCTTTCCCTGGGG - Exonic
1080840486 11:35979190-35979212 AGGCATGTGGTTTTTCCTTTGGG + Intronic
1081778787 11:45695541-45695563 TGGCTGGAGCTCTTTCCTTCTGG - Intergenic
1083544179 11:63536929-63536951 TGGACTGAGGCCTTTCCTAGGGG - Intronic
1084758921 11:71256127-71256149 GGCCATGAGCTCTTCCCTTGAGG + Intergenic
1085229415 11:74951839-74951861 AGGAATGAGGCCTTTCCTTCAGG - Intronic
1085861027 11:80236159-80236181 TGGTATGAGATATTTCATTGTGG - Intergenic
1086041499 11:82485021-82485043 TGGCATGAGCTATTTCCTCCTGG + Intergenic
1090070713 11:123542598-123542620 TGGAATGAGGTCATTCTATGCGG + Intronic
1090763957 11:129860966-129860988 TAACATGTGTTCTTTCCTTGGGG + Intergenic
1093077901 12:14775830-14775852 TGGAATGAGGTCATTGCTTCAGG - Intronic
1093966968 12:25338103-25338125 TGACATGTGGTTATTCCTTGAGG + Intergenic
1100331395 12:93585729-93585751 AGGCTTGAGATCTTTCCTTTTGG - Intergenic
1100357515 12:93845162-93845184 AGTCATGAGGCCTGTCCTTGGGG - Intronic
1101739914 12:107492797-107492819 TGGCACTAGGTTTTTCCCTGTGG - Intronic
1102494479 12:113309890-113309912 GGGCATGAGGTCTCTTTTTGGGG + Intronic
1103904352 12:124319967-124319989 TGGGATGACATCTTTCTTTGGGG + Intergenic
1103904360 12:124319995-124320017 TGGGATGACCTCTTTCTTTGGGG + Intergenic
1103904369 12:124320023-124320045 TGGGATGACCTCTTTCTTTGGGG + Intergenic
1103904378 12:124320051-124320073 TGGGATGACCTCTTTCTTTGGGG + Intergenic
1103904394 12:124320107-124320129 TGGGATGACCTCTTTCTTTGGGG + Intergenic
1103904409 12:124320159-124320181 TGGGATGACCTCTTTCTTTGGGG + Intergenic
1103904487 12:124320463-124320485 TGGGATGACCTCTTTCTTTGGGG + Intergenic
1103904509 12:124320547-124320569 TGGGATGACCTCTTTCTTTGGGG + Intergenic
1103904517 12:124320575-124320597 TGGGATGACCTCTTTCTTTGGGG + Intergenic
1103904525 12:124320603-124320625 TGGGATGACCTCTTTCTTTGGGG + Intergenic
1103904533 12:124320631-124320653 TGGGATGACCTCTTTCTTTGGGG + Intergenic
1103904541 12:124320659-124320681 TGGGATGACCTCTTTCTTTGGGG + Intergenic
1103981762 12:124741362-124741384 AGGGATGAGGCCTTTCCCTGGGG - Intergenic
1105458489 13:20562867-20562889 AGGCATGGGGTTTTACCTTGTGG + Intergenic
1107939072 13:45368431-45368453 TGGAATTAGGTATTTCCTTGTGG - Intergenic
1110820837 13:79914204-79914226 TGACATTATGTGTTTCCTTGTGG + Intergenic
1111130682 13:83971249-83971271 TAGCATAGGGTCTATCCTTGAGG - Intergenic
1113038551 13:106078732-106078754 AGGCATGATGTCTTTACTGGAGG - Intergenic
1115958606 14:38809560-38809582 TCCCATGGGGTGTTTCCTTGAGG - Intergenic
1118774474 14:68965148-68965170 TGCCATGAGTTCATTCCTTGTGG - Intronic
1119155261 14:72404462-72404484 TGGCATCAGGGGTTTCCCTGGGG - Intronic
1120074366 14:80138964-80138986 TGGCATTAGTACTCTCCTTGGGG + Intergenic
1120196606 14:81490879-81490901 TGATATGAGGTCTTGCTTTGTGG - Intronic
1121315426 14:92958480-92958502 TGGCATGAGGACTCCCCTAGAGG + Intronic
1124359428 15:29024889-29024911 TGGCCTGAGGTATAGCCTTGGGG + Intronic
1126333986 15:47566150-47566172 CTGGATGAGGTCATTCCTTGAGG + Intronic
1126786594 15:52182072-52182094 TGGCCTGAGGGATTTACTTGTGG + Intronic
1128656954 15:69469573-69469595 AGGCCTGGGGTCTTTCCGTGGGG + Intergenic
1129098113 15:73231281-73231303 TAGCATGTGGTCTATCCTGGAGG - Intronic
1130640703 15:85671918-85671940 TGACATGCTTTCTTTCCTTGTGG + Intronic
1131453272 15:92563662-92563684 TGGCATAGGATCTTTCTTTGAGG - Intergenic
1131745315 15:95441123-95441145 TTTCATGAGGTCTTTCACTGAGG - Intergenic
1135462738 16:22659345-22659367 TCGCACGAAGTCTTTCCATGAGG - Intergenic
1135508658 16:23061661-23061683 AGGCAGGATGTCTTTCCTAGAGG - Exonic
1138810025 16:60139083-60139105 TGGCAGTAGCTCTTTCCTTCAGG - Intergenic
1139230022 16:65274643-65274665 GGGGATGAGCTCTTTCCTTTTGG + Intergenic
1140829245 16:78736175-78736197 TGGCTTCAGGTTTATCCTTGGGG + Intronic
1141142720 16:81507512-81507534 TGGAATGAGCATTTTCCTTGAGG + Intronic
1144227711 17:13166930-13166952 AGGCATGAGGTCGTTTCTTGAGG - Intergenic
1144752324 17:17657755-17657777 TGGCCTCTGCTCTTTCCTTGGGG + Intergenic
1146605756 17:34256365-34256387 TGGCCTGAAGTTCTTCCTTGTGG + Intronic
1146681319 17:34810446-34810468 AGGCATCAGGCCTTTCTTTGTGG + Intergenic
1147540583 17:41354428-41354450 TGGCATGAGGTCTGAGCTTCGGG + Intergenic
1147795298 17:43037869-43037891 TGGCGGGAGGTCTTTCCTGGAGG - Intergenic
1153064137 18:1025795-1025817 TCGGATGAGGAGTTTCCTTGAGG + Intergenic
1158845534 18:61438547-61438569 TGGCATGAGATATCTCATTGTGG - Intronic
1161057295 19:2197101-2197123 TGGCCTGCGGTGCTTCCTTGCGG + Intronic
1161064854 19:2232609-2232631 TGGCATGAGGCGTCTCCTGGCGG + Intronic
1165189566 19:34051360-34051382 TGGCCTGATGTCATTCCCTGTGG - Intergenic
1166333282 19:42090840-42090862 TGGCATGAGGTCTGACCTGCTGG + Exonic
1168031817 19:53686102-53686124 TGGCCTGTGGTCTCTCCTGGAGG + Intergenic
925973298 2:9122932-9122954 AGGCATGAGGTTTCTCTTTGGGG + Intergenic
929802716 2:45117842-45117864 GGGCAAGAAGTCTTCCCTTGAGG + Intergenic
931577781 2:63737591-63737613 TGGGATGAGTTCTTTCCTGGAGG + Intronic
932277099 2:70459765-70459787 TGGCATGAAGACTTTCCTAAGGG - Intronic
932471969 2:71965211-71965233 AGGCATGAGCTCTTTCCTCCTGG - Intergenic
933416480 2:81993101-81993123 AGACATGAGGTCTCTCCTTGTGG + Intergenic
933888774 2:86745445-86745467 TGAGATGAGATTTTTCCTTGAGG + Intronic
934046690 2:88178583-88178605 AGGCATGATTTCTGTCCTTGAGG + Intronic
935082499 2:99812063-99812085 TGTCCTGATGTCTTACCTTGAGG + Intronic
935236968 2:101147549-101147571 TGGAGTGCGGTATTTCCTTGTGG + Intronic
935748152 2:106207486-106207508 AGGCATGGGGTTTTTCCATGTGG - Intergenic
937428280 2:121817631-121817653 AGAGATGAGGTCTTTCATTGAGG + Intergenic
937977709 2:127591811-127591833 TGGCATGATGTCCTTCCCTGGGG - Intronic
938962108 2:136353335-136353357 AGGCATGAGGTACTTCCTTCTGG + Intergenic
940042805 2:149377944-149377966 TGGCATGAGGTCAGGCCCTGGGG + Intronic
941560489 2:167037493-167037515 TGGCTTGAGGTTTTTTCATGTGG + Intronic
943114812 2:183655083-183655105 TGGCATTAAATCTTTTCTTGAGG + Intergenic
944669516 2:201983617-201983639 TGGCTTCAGGGTTTTCCTTGGGG + Intergenic
947604888 2:231479516-231479538 TGGCGGGAGGTGTTTCCTCGGGG - Intronic
948204487 2:236156096-236156118 GGGCATGAGGGCCTTCCTGGGGG - Intergenic
1169189701 20:3650420-3650442 TCCCAGGAGATCTTTCCTTGTGG + Exonic
1170035253 20:11982575-11982597 TGGCATGAGGGCTTTTCATTAGG + Intergenic
1170481337 20:16768050-16768072 TGGCATGAGGTCTTTCCTTGTGG + Intronic
1170871839 20:20213095-20213117 TGGCATTAGCTGCTTCCTTGTGG - Intronic
1170917055 20:20637036-20637058 TTTCCTGAAGTCTTTCCTTGTGG - Intronic
1180131751 21:45831090-45831112 AGTCAGGAGGCCTTTCCTTGAGG - Intronic
951421960 3:22497171-22497193 TGTCATGATCTCTTTTCTTGTGG + Intergenic
955688263 3:61565175-61565197 TGGCATGAGCTTTTTCCCAGTGG + Intronic
955936317 3:64106117-64106139 AGGCATGCTTTCTTTCCTTGGGG - Intronic
958830637 3:99084486-99084508 TGGTCTGAGTTTTTTCCTTGTGG + Intergenic
960130364 3:114049317-114049339 TGGCACATGGTCTTTCCTTTAGG + Intronic
960697134 3:120407187-120407209 TGTCATGAGATCTGTTCTTGGGG + Intronic
961497878 3:127307265-127307287 TGGCATGAGGCCATGCCCTGAGG + Intergenic
961522345 3:127473965-127473987 TGGCTTGAGTTCTTAGCTTGTGG - Intergenic
964716488 3:159728141-159728163 TGGCATATGGTCTGTCCTTAAGG - Intronic
968001331 3:195208871-195208893 TTGCAAGAGGAGTTTCCTTGAGG + Intronic
969564562 4:7970443-7970465 TGGCATCAGGTCTTTGCTGGAGG + Intronic
970092074 4:12421023-12421045 TTCCATGAGGAATTTCCTTGTGG - Intergenic
973607611 4:52603220-52603242 TGGCCTGGGGTCTTCCTTTGTGG - Intronic
975606251 4:76157245-76157267 TGGCATGAGGAATTTTATTGAGG + Intergenic
976744247 4:88387849-88387871 TGGTGTGAATTCTTTCCTTGGGG + Intronic
977181197 4:93876867-93876889 TGTCAAGAGCTCTTTCATTGTGG + Intergenic
978645923 4:110931732-110931754 TTTCATGAGGTCTTTTCTTCTGG + Intergenic
980211528 4:129794608-129794630 TGGCAAATGGCCTTTCCTTGCGG + Intergenic
983543776 4:168940724-168940746 TGGCATGAGATATCTCATTGTGG - Intronic
984314236 4:178105593-178105615 TGGGATGAGATATTTCATTGTGG + Intergenic
985038393 4:185864217-185864239 TGGCATGAGTGTTTTTCTTGAGG - Intronic
985618407 5:938384-938406 TGGGCTGAGGTCTGTCCTGGAGG - Intergenic
986349833 5:6867162-6867184 TGGCAAGATTTATTTCCTTGTGG + Intergenic
987148098 5:15012308-15012330 TGGGATGAGGGCTGTCCTAGAGG + Intergenic
987820728 5:22962956-22962978 TGGAATGAGGACTTTCCTTACGG - Intergenic
987904185 5:24054223-24054245 TAGTATGTGGTCTATCCTTGAGG - Intronic
989670104 5:43906762-43906784 TGGCATAATTTATTTCCTTGTGG - Intergenic
989785257 5:45319576-45319598 TGACATGAGTTCTTTTTTTGGGG + Intronic
991533319 5:67638790-67638812 TGGCCTGAGATTTTCCCTTGAGG - Intergenic
991547607 5:67800674-67800696 TAGCATGATGTCTTACATTGGGG - Intergenic
992738458 5:79747789-79747811 AGACCTGAGGTCTTTCCTTCTGG + Intronic
992869267 5:80990180-80990202 TAGTAAGAGGTCTTTCCTTTAGG - Intronic
993056417 5:82985753-82985775 TGGAATGAGCTCTTTCTTTAGGG + Intergenic
993132119 5:83912065-83912087 TGACAGGAGCTCTTTCCTTAGGG + Intergenic
996034842 5:118747249-118747271 TGGAAGGGTGTCTTTCCTTGGGG - Intergenic
996733502 5:126738074-126738096 GGGAAAGAGGTCTCTCCTTGCGG - Intergenic
997477677 5:134155158-134155180 TGGCATTAAGTCATACCTTGAGG - Exonic
998945074 5:147330237-147330259 TGGCAGGAGGTATTTCCTTGTGG + Intronic
1006071354 6:31499585-31499607 TAGCATCAGGGCTCTCCTTGGGG - Intronic
1007803373 6:44417283-44417305 CTGCATGTGGTCTTTCCATGAGG + Intronic
1010285009 6:74066712-74066734 AGACATGAAGTCATTCCTTGAGG - Intergenic
1011102650 6:83741134-83741156 TAGCATATGGTCTATCCTTGAGG + Intergenic
1012149917 6:95735794-95735816 TGGCTTGAGTACTTCCCTTGTGG + Intergenic
1013913975 6:115311825-115311847 TGGTATCATTTCTTTCCTTGTGG + Intergenic
1014214461 6:118739063-118739085 TAGCCTGAGGTCTCTCCTTTAGG - Intergenic
1017058109 6:150455974-150455996 AGGTATGAGATCTTTGCTTGGGG - Intergenic
1019147317 6:169983702-169983724 TGCCTTGTGGTTTTTCCTTGTGG - Intergenic
1019909629 7:4091965-4091987 TGTCACGATGTCTTTCCTGGGGG - Intronic
1020239043 7:6378194-6378216 TGGGATGAGTTTTTTCCTTCTGG + Intronic
1026654341 7:72243777-72243799 TAGAATGAGTTCTTTCCTTCGGG - Intronic
1027279801 7:76599693-76599715 TGGCTTGACATCTTTCCTTTAGG - Intergenic
1029404989 7:100369389-100369411 TGGCATCAGGTCTGAGCTTGGGG - Intronic
1034105341 7:148484956-148484978 AGGCATGAGGTCTTTTTTGGTGG + Intergenic
1034841316 7:154400184-154400206 AGGCCTGAGGGCTCTCCTTGCGG + Intronic
1035515147 8:226459-226481 TGAAATGAGGACTTTCCTTCTGG + Intergenic
1039468765 8:37801125-37801147 TGGCGGGAGGGCTTTCCATGCGG - Intronic
1040519423 8:48162350-48162372 TGGCATGAGCTATCTCATTGTGG + Intergenic
1041928679 8:63264870-63264892 TGACATGAGCTCCTTTCTTGTGG - Intergenic
1046484457 8:114868007-114868029 TGGAATGAGGTGTATCCTTGGGG - Intergenic
1047795173 8:128247974-128247996 TAGGATGAGTTCTTTCATTGTGG - Intergenic
1048165682 8:132059415-132059437 TGGCTAAGGGTCTTTCCTTGGGG - Intronic
1051168293 9:14290041-14290063 TTTCATGAGGTCTTTCATTTGGG - Intronic
1051209095 9:14722614-14722636 TGCCGTGTGGTCTTTCCTAGAGG + Exonic
1051527985 9:18068571-18068593 TGGGTTGAAGCCTTTCCTTGTGG - Intergenic
1053229117 9:36390915-36390937 TAGCATGAAGTCTGTCCTTTAGG - Intronic
1055327992 9:75152149-75152171 TGGCATGAAGCATTTTCTTGTGG - Intergenic
1186192824 X:7082784-7082806 TGGCATGCTGTCTTTCTTAGGGG + Intronic
1189224437 X:39400944-39400966 TGGCAAGGGGTCTTTCCCTGGGG - Intergenic
1189407375 X:40736629-40736651 TGGCTTGAGGTCTGGGCTTGGGG + Intergenic
1191980131 X:66916424-66916446 TTGCATGTGCTGTTTCCTTGTGG + Intergenic
1193297591 X:79851223-79851245 TGTAATGAGGTCTTTCCTCAAGG - Intergenic
1194254986 X:91624320-91624342 TGGCATGAGGTCACTGCTAGTGG + Intergenic
1195286943 X:103395128-103395150 TTGAATGAGGTCTGTTCTTGAGG - Intergenic
1197450519 X:126609002-126609024 TGACATGAAGTCCTTCCTTTGGG + Intergenic
1197845221 X:130794343-130794365 TGTAATGAGGTCTTCCCTTCAGG + Intronic
1198720994 X:139620214-139620236 TGGAATCAGTTATTTCCTTGAGG - Intronic
1199735165 X:150679310-150679332 TCGCAAGAGCTCTTTCATTGAGG + Intergenic
1200208977 X:154337339-154337361 TGGGATGAGGTGTTTGCTTCTGG + Intergenic
1200221899 X:154394789-154394811 TGGGATGAGGTGTTTGCTTCTGG - Intronic
1200573771 Y:4863923-4863945 TGGCATGAGGTCACTGCTAGTGG + Intergenic
1201564659 Y:15353567-15353589 TGGCATGCTGTCTTTCTTAGGGG + Intergenic