ID: 1170485424

View in Genome Browser
Species Human (GRCh38)
Location 20:16810866-16810888
Sequence GCATCCTTCACAGCTGGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170485417_1170485424 25 Left 1170485417 20:16810818-16810840 CCCGTGATCATTTTGAGCTAGTT No data
Right 1170485424 20:16810866-16810888 GCATCCTTCACAGCTGGTGTAGG No data
1170485422_1170485424 -5 Left 1170485422 20:16810848-16810870 CCAGAAGATTAAAATTGGGCATC No data
Right 1170485424 20:16810866-16810888 GCATCCTTCACAGCTGGTGTAGG No data
1170485418_1170485424 24 Left 1170485418 20:16810819-16810841 CCGTGATCATTTTGAGCTAGTTA No data
Right 1170485424 20:16810866-16810888 GCATCCTTCACAGCTGGTGTAGG No data
1170485420_1170485424 -1 Left 1170485420 20:16810844-16810866 CCATCCAGAAGATTAAAATTGGG No data
Right 1170485424 20:16810866-16810888 GCATCCTTCACAGCTGGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170485424 Original CRISPR GCATCCTTCACAGCTGGTGT AGG Intergenic
No off target data available for this crispr