ID: 1170485618

View in Genome Browser
Species Human (GRCh38)
Location 20:16813029-16813051
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170485618_1170485625 3 Left 1170485618 20:16813029-16813051 CCCAAGTAGACCTACCTCCTTCT No data
Right 1170485625 20:16813055-16813077 GCTGGGTTTCATTACCTCTGAGG No data
1170485618_1170485626 4 Left 1170485618 20:16813029-16813051 CCCAAGTAGACCTACCTCCTTCT No data
Right 1170485626 20:16813056-16813078 CTGGGTTTCATTACCTCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170485618 Original CRISPR AGAAGGAGGTAGGTCTACTT GGG (reversed) Intergenic
No off target data available for this crispr