ID: 1170485623

View in Genome Browser
Species Human (GRCh38)
Location 20:16813043-16813065
Sequence TGAAACCCAGCTGCAGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170485623_1170485628 17 Left 1170485623 20:16813043-16813065 CCTCCTTCTGCAGCTGGGTTTCA No data
Right 1170485628 20:16813083-16813105 CTGAGTTAGCAACTTCATAGTGG No data
1170485623_1170485626 -10 Left 1170485623 20:16813043-16813065 CCTCCTTCTGCAGCTGGGTTTCA No data
Right 1170485626 20:16813056-16813078 CTGGGTTTCATTACCTCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170485623 Original CRISPR TGAAACCCAGCTGCAGAAGG AGG (reversed) Intergenic
No off target data available for this crispr