ID: 1170485625

View in Genome Browser
Species Human (GRCh38)
Location 20:16813055-16813077
Sequence GCTGGGTTTCATTACCTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170485619_1170485625 2 Left 1170485619 20:16813030-16813052 CCAAGTAGACCTACCTCCTTCTG No data
Right 1170485625 20:16813055-16813077 GCTGGGTTTCATTACCTCTGAGG No data
1170485616_1170485625 5 Left 1170485616 20:16813027-16813049 CCCCCAAGTAGACCTACCTCCTT No data
Right 1170485625 20:16813055-16813077 GCTGGGTTTCATTACCTCTGAGG No data
1170485618_1170485625 3 Left 1170485618 20:16813029-16813051 CCCAAGTAGACCTACCTCCTTCT No data
Right 1170485625 20:16813055-16813077 GCTGGGTTTCATTACCTCTGAGG No data
1170485615_1170485625 6 Left 1170485615 20:16813026-16813048 CCCCCCAAGTAGACCTACCTCCT No data
Right 1170485625 20:16813055-16813077 GCTGGGTTTCATTACCTCTGAGG No data
1170485617_1170485625 4 Left 1170485617 20:16813028-16813050 CCCCAAGTAGACCTACCTCCTTC No data
Right 1170485625 20:16813055-16813077 GCTGGGTTTCATTACCTCTGAGG No data
1170485622_1170485625 -7 Left 1170485622 20:16813039-16813061 CCTACCTCCTTCTGCAGCTGGGT No data
Right 1170485625 20:16813055-16813077 GCTGGGTTTCATTACCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170485625 Original CRISPR GCTGGGTTTCATTACCTCTG AGG Intergenic
No off target data available for this crispr