ID: 1170485627

View in Genome Browser
Species Human (GRCh38)
Location 20:16813069-16813091
Sequence CTAACTCAGCTTGCCCTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170485627_1170485628 -9 Left 1170485627 20:16813069-16813091 CCTCTGAGGGCAAGCTGAGTTAG No data
Right 1170485628 20:16813083-16813105 CTGAGTTAGCAACTTCATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170485627 Original CRISPR CTAACTCAGCTTGCCCTCAG AGG (reversed) Intergenic
No off target data available for this crispr