ID: 1170485628

View in Genome Browser
Species Human (GRCh38)
Location 20:16813083-16813105
Sequence CTGAGTTAGCAACTTCATAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170485627_1170485628 -9 Left 1170485627 20:16813069-16813091 CCTCTGAGGGCAAGCTGAGTTAG No data
Right 1170485628 20:16813083-16813105 CTGAGTTAGCAACTTCATAGTGG No data
1170485622_1170485628 21 Left 1170485622 20:16813039-16813061 CCTACCTCCTTCTGCAGCTGGGT No data
Right 1170485628 20:16813083-16813105 CTGAGTTAGCAACTTCATAGTGG No data
1170485623_1170485628 17 Left 1170485623 20:16813043-16813065 CCTCCTTCTGCAGCTGGGTTTCA No data
Right 1170485628 20:16813083-16813105 CTGAGTTAGCAACTTCATAGTGG No data
1170485624_1170485628 14 Left 1170485624 20:16813046-16813068 CCTTCTGCAGCTGGGTTTCATTA No data
Right 1170485628 20:16813083-16813105 CTGAGTTAGCAACTTCATAGTGG No data
1170485619_1170485628 30 Left 1170485619 20:16813030-16813052 CCAAGTAGACCTACCTCCTTCTG No data
Right 1170485628 20:16813083-16813105 CTGAGTTAGCAACTTCATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170485628 Original CRISPR CTGAGTTAGCAACTTCATAG TGG Intergenic
No off target data available for this crispr