ID: 1170495426

View in Genome Browser
Species Human (GRCh38)
Location 20:16919540-16919562
Sequence AAACTCATGGGGTCATAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170495422_1170495426 16 Left 1170495422 20:16919501-16919523 CCTTAGTGAATTATTTGGGTTCT No data
Right 1170495426 20:16919540-16919562 AAACTCATGGGGTCATAGAAAGG No data
1170495419_1170495426 27 Left 1170495419 20:16919490-16919512 CCTTTATTATTCCTTAGTGAATT No data
Right 1170495426 20:16919540-16919562 AAACTCATGGGGTCATAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170495426 Original CRISPR AAACTCATGGGGTCATAGAA AGG Intergenic
No off target data available for this crispr