ID: 1170495792

View in Genome Browser
Species Human (GRCh38)
Location 20:16923861-16923883
Sequence TCATGGATCCTGCTTCTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170495792_1170495795 14 Left 1170495792 20:16923861-16923883 CCTCTCAGAAGCAGGATCCATGA No data
Right 1170495795 20:16923898-16923920 CTGGTTTTATTATGAAGCAGTGG No data
1170495792_1170495794 -5 Left 1170495792 20:16923861-16923883 CCTCTCAGAAGCAGGATCCATGA No data
Right 1170495794 20:16923879-16923901 CATGAAATAGTACAGTTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170495792 Original CRISPR TCATGGATCCTGCTTCTGAG AGG (reversed) Intergenic
No off target data available for this crispr