ID: 1170495795

View in Genome Browser
Species Human (GRCh38)
Location 20:16923898-16923920
Sequence CTGGTTTTATTATGAAGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170495792_1170495795 14 Left 1170495792 20:16923861-16923883 CCTCTCAGAAGCAGGATCCATGA No data
Right 1170495795 20:16923898-16923920 CTGGTTTTATTATGAAGCAGTGG No data
1170495793_1170495795 -3 Left 1170495793 20:16923878-16923900 CCATGAAATAGTACAGTTAGCTG No data
Right 1170495795 20:16923898-16923920 CTGGTTTTATTATGAAGCAGTGG No data
1170495790_1170495795 22 Left 1170495790 20:16923853-16923875 CCTTAAGGCCTCTCAGAAGCAGG No data
Right 1170495795 20:16923898-16923920 CTGGTTTTATTATGAAGCAGTGG No data
1170495789_1170495795 23 Left 1170495789 20:16923852-16923874 CCCTTAAGGCCTCTCAGAAGCAG No data
Right 1170495795 20:16923898-16923920 CTGGTTTTATTATGAAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170495795 Original CRISPR CTGGTTTTATTATGAAGCAG TGG Intergenic
No off target data available for this crispr