ID: 1170495874

View in Genome Browser
Species Human (GRCh38)
Location 20:16924781-16924803
Sequence CTGCCCTGTCTACTTTAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170495872_1170495874 9 Left 1170495872 20:16924749-16924771 CCATTCTTGCTCGCTCATTGTAA No data
Right 1170495874 20:16924781-16924803 CTGCCCTGTCTACTTTAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170495874 Original CRISPR CTGCCCTGTCTACTTTAAGG TGG Intergenic
No off target data available for this crispr