ID: 1170496449

View in Genome Browser
Species Human (GRCh38)
Location 20:16929757-16929779
Sequence ATTGTGAAGGGGATTGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170496444_1170496449 14 Left 1170496444 20:16929720-16929742 CCTCATGCACACATAGGTGCTAT No data
Right 1170496449 20:16929757-16929779 ATTGTGAAGGGGATTGTGAAGGG No data
1170496443_1170496449 15 Left 1170496443 20:16929719-16929741 CCCTCATGCACACATAGGTGCTA No data
Right 1170496449 20:16929757-16929779 ATTGTGAAGGGGATTGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170496449 Original CRISPR ATTGTGAAGGGGATTGTGAA GGG Intergenic
No off target data available for this crispr