ID: 1170500120

View in Genome Browser
Species Human (GRCh38)
Location 20:16966890-16966912
Sequence TCTGAGGCCCAGAAGAAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170500120_1170500124 19 Left 1170500120 20:16966890-16966912 CCTTGCTTCTTCTGGGCCTCAGA No data
Right 1170500124 20:16966932-16966954 TGACCACAAATCTCTTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170500120 Original CRISPR TCTGAGGCCCAGAAGAAGCA AGG (reversed) Intergenic
No off target data available for this crispr