ID: 1170502765

View in Genome Browser
Species Human (GRCh38)
Location 20:16991599-16991621
Sequence CTGAAGTCACAGATTGACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170502764_1170502765 -10 Left 1170502764 20:16991586-16991608 CCATAAAAAGCTGCTGAAGTCAC No data
Right 1170502765 20:16991599-16991621 CTGAAGTCACAGATTGACCATGG No data
1170502763_1170502765 -1 Left 1170502763 20:16991577-16991599 CCTGTTGGTCCATAAAAAGCTGC No data
Right 1170502765 20:16991599-16991621 CTGAAGTCACAGATTGACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170502765 Original CRISPR CTGAAGTCACAGATTGACCA TGG Intergenic
No off target data available for this crispr