ID: 1170503419

View in Genome Browser
Species Human (GRCh38)
Location 20:16998649-16998671
Sequence ATGTGAATAGGAAGCTAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170503414_1170503419 -2 Left 1170503414 20:16998628-16998650 CCCTAAACTGATTATTTCCAAAT No data
Right 1170503419 20:16998649-16998671 ATGTGAATAGGAAGCTAGCAGGG No data
1170503415_1170503419 -3 Left 1170503415 20:16998629-16998651 CCTAAACTGATTATTTCCAAATG No data
Right 1170503419 20:16998649-16998671 ATGTGAATAGGAAGCTAGCAGGG No data
1170503413_1170503419 7 Left 1170503413 20:16998619-16998641 CCTAAATTACCCTAAACTGATTA No data
Right 1170503419 20:16998649-16998671 ATGTGAATAGGAAGCTAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170503419 Original CRISPR ATGTGAATAGGAAGCTAGCA GGG Intergenic
No off target data available for this crispr