ID: 1170504037

View in Genome Browser
Species Human (GRCh38)
Location 20:17005582-17005604
Sequence CATTATGTCCAGATGGACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170504033_1170504037 4 Left 1170504033 20:17005555-17005577 CCAGCAGGTTGCTCAATTCAGTG No data
Right 1170504037 20:17005582-17005604 CATTATGTCCAGATGGACCCAGG No data
1170504032_1170504037 5 Left 1170504032 20:17005554-17005576 CCCAGCAGGTTGCTCAATTCAGT No data
Right 1170504037 20:17005582-17005604 CATTATGTCCAGATGGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170504037 Original CRISPR CATTATGTCCAGATGGACCC AGG Intergenic
No off target data available for this crispr