ID: 1170509268

View in Genome Browser
Species Human (GRCh38)
Location 20:17060007-17060029
Sequence CAAGCTGATACCTGGTAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170509268_1170509274 9 Left 1170509268 20:17060007-17060029 CCTGGTTACCAGGTATCAGCTTG No data
Right 1170509274 20:17060039-17060061 ATTACCACTGAGGGTGCCTGTGG No data
1170509268_1170509272 0 Left 1170509268 20:17060007-17060029 CCTGGTTACCAGGTATCAGCTTG No data
Right 1170509272 20:17060030-17060052 CCAGACTCCATTACCACTGAGGG No data
1170509268_1170509270 -1 Left 1170509268 20:17060007-17060029 CCTGGTTACCAGGTATCAGCTTG No data
Right 1170509270 20:17060029-17060051 GCCAGACTCCATTACCACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170509268 Original CRISPR CAAGCTGATACCTGGTAACC AGG (reversed) Intergenic
No off target data available for this crispr