ID: 1170509613

View in Genome Browser
Species Human (GRCh38)
Location 20:17063398-17063420
Sequence CACTCCCTCATTGTGTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170509613_1170509619 -6 Left 1170509613 20:17063398-17063420 CCACAAAACACAATGAGGGAGTG No data
Right 1170509619 20:17063415-17063437 GGAGTGGGGAGAGTGTGACGGGG No data
1170509613_1170509623 29 Left 1170509613 20:17063398-17063420 CCACAAAACACAATGAGGGAGTG No data
Right 1170509623 20:17063450-17063472 CCAATAAAGAGTATATTGATGGG No data
1170509613_1170509621 28 Left 1170509613 20:17063398-17063420 CCACAAAACACAATGAGGGAGTG No data
Right 1170509621 20:17063449-17063471 GCCAATAAAGAGTATATTGATGG No data
1170509613_1170509618 -7 Left 1170509613 20:17063398-17063420 CCACAAAACACAATGAGGGAGTG No data
Right 1170509618 20:17063414-17063436 GGGAGTGGGGAGAGTGTGACGGG No data
1170509613_1170509617 -8 Left 1170509613 20:17063398-17063420 CCACAAAACACAATGAGGGAGTG No data
Right 1170509617 20:17063413-17063435 AGGGAGTGGGGAGAGTGTGACGG No data
1170509613_1170509620 -3 Left 1170509613 20:17063398-17063420 CCACAAAACACAATGAGGGAGTG No data
Right 1170509620 20:17063418-17063440 GTGGGGAGAGTGTGACGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170509613 Original CRISPR CACTCCCTCATTGTGTTTTG TGG (reversed) Intergenic
No off target data available for this crispr