ID: 1170509621

View in Genome Browser
Species Human (GRCh38)
Location 20:17063449-17063471
Sequence GCCAATAAAGAGTATATTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170509613_1170509621 28 Left 1170509613 20:17063398-17063420 CCACAAAACACAATGAGGGAGTG No data
Right 1170509621 20:17063449-17063471 GCCAATAAAGAGTATATTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170509621 Original CRISPR GCCAATAAAGAGTATATTGA TGG Intergenic
No off target data available for this crispr