ID: 1170509623

View in Genome Browser
Species Human (GRCh38)
Location 20:17063450-17063472
Sequence CCAATAAAGAGTATATTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170509613_1170509623 29 Left 1170509613 20:17063398-17063420 CCACAAAACACAATGAGGGAGTG No data
Right 1170509623 20:17063450-17063472 CCAATAAAGAGTATATTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170509623 Original CRISPR CCAATAAAGAGTATATTGAT GGG Intergenic
No off target data available for this crispr