ID: 1170509774

View in Genome Browser
Species Human (GRCh38)
Location 20:17064758-17064780
Sequence GCGTGTTAGACCTTCCACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170509774_1170509778 -10 Left 1170509774 20:17064758-17064780 CCATGGTGGAAGGTCTAACACGC No data
Right 1170509778 20:17064771-17064793 TCTAACACGCAAGTAGGGGAAGG No data
1170509774_1170509780 15 Left 1170509774 20:17064758-17064780 CCATGGTGGAAGGTCTAACACGC No data
Right 1170509780 20:17064796-17064818 ACTGAACTCATCCTTTTATCAGG No data
1170509774_1170509779 -9 Left 1170509774 20:17064758-17064780 CCATGGTGGAAGGTCTAACACGC No data
Right 1170509779 20:17064772-17064794 CTAACACGCAAGTAGGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170509774 Original CRISPR GCGTGTTAGACCTTCCACCA TGG (reversed) Intergenic
No off target data available for this crispr