ID: 1170517500

View in Genome Browser
Species Human (GRCh38)
Location 20:17147045-17147067
Sequence CCCCAATGCCCGACAGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170517500_1170517508 -10 Left 1170517500 20:17147045-17147067 CCATGGCCTGTCGGGCATTGGGG No data
Right 1170517508 20:17147058-17147080 GGCATTGGGGGACTAGGGGAGGG No data
1170517500_1170517511 26 Left 1170517500 20:17147045-17147067 CCATGGCCTGTCGGGCATTGGGG No data
Right 1170517511 20:17147094-17147116 AAATACCTAATGCAGATGACGGG 0: 57
1: 1876
2: 3042
3: 1911
4: 862
1170517500_1170517509 1 Left 1170517500 20:17147045-17147067 CCATGGCCTGTCGGGCATTGGGG No data
Right 1170517509 20:17147069-17147091 ACTAGGGGAGGGATAGCATTAGG 0: 227
1: 2061
2: 3934
3: 6571
4: 18589
1170517500_1170517510 25 Left 1170517500 20:17147045-17147067 CCATGGCCTGTCGGGCATTGGGG No data
Right 1170517510 20:17147093-17147115 GAAATACCTAATGCAGATGACGG 0: 57
1: 2246
2: 2215
3: 1018
4: 522

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170517500 Original CRISPR CCCCAATGCCCGACAGGCCA TGG (reversed) Intergenic
No off target data available for this crispr