ID: 1170518356

View in Genome Browser
Species Human (GRCh38)
Location 20:17155612-17155634
Sequence CCGTGAGTGGCTTTTGCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170518356_1170518359 -9 Left 1170518356 20:17155612-17155634 CCATATGCAAAAGCCACTCACGG No data
Right 1170518359 20:17155626-17155648 CACTCACGGACAACCACCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170518356 Original CRISPR CCGTGAGTGGCTTTTGCATA TGG (reversed) Intergenic
No off target data available for this crispr