ID: 1170524865

View in Genome Browser
Species Human (GRCh38)
Location 20:17227325-17227347
Sequence CCCGGCGGCCGCCTTCCACT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 92}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170524865_1170524872 20 Left 1170524865 20:17227325-17227347 CCCAGTGGAAGGCGGCCGCCGGG 0: 1
1: 0
2: 2
3: 8
4: 92
Right 1170524872 20:17227368-17227390 TTTTGCATCTGCTGAGCGACCGG 0: 1
1: 0
2: 1
3: 21
4: 294
1170524865_1170524870 -4 Left 1170524865 20:17227325-17227347 CCCAGTGGAAGGCGGCCGCCGGG 0: 1
1: 0
2: 2
3: 8
4: 92
Right 1170524870 20:17227344-17227366 CGGGTTCCTCTTCTGTGTCATGG 0: 1
1: 0
2: 0
3: 25
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170524865 Original CRISPR CCCGGCGGCCGCCTTCCACT GGG (reversed) Exonic