ID: 1170524870

View in Genome Browser
Species Human (GRCh38)
Location 20:17227344-17227366
Sequence CGGGTTCCTCTTCTGTGTCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 289}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170524859_1170524870 26 Left 1170524859 20:17227295-17227317 CCCAAAGAAGGATGAAGGGTGGT 0: 1
1: 0
2: 1
3: 13
4: 191
Right 1170524870 20:17227344-17227366 CGGGTTCCTCTTCTGTGTCATGG 0: 1
1: 0
2: 0
3: 25
4: 289
1170524860_1170524870 25 Left 1170524860 20:17227296-17227318 CCAAAGAAGGATGAAGGGTGGTT 0: 1
1: 0
2: 0
3: 14
4: 150
Right 1170524870 20:17227344-17227366 CGGGTTCCTCTTCTGTGTCATGG 0: 1
1: 0
2: 0
3: 25
4: 289
1170524867_1170524870 -5 Left 1170524867 20:17227326-17227348 CCAGTGGAAGGCGGCCGCCGGGT 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1170524870 20:17227344-17227366 CGGGTTCCTCTTCTGTGTCATGG 0: 1
1: 0
2: 0
3: 25
4: 289
1170524865_1170524870 -4 Left 1170524865 20:17227325-17227347 CCCAGTGGAAGGCGGCCGCCGGG 0: 1
1: 0
2: 2
3: 8
4: 92
Right 1170524870 20:17227344-17227366 CGGGTTCCTCTTCTGTGTCATGG 0: 1
1: 0
2: 0
3: 25
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170524870 Original CRISPR CGGGTTCCTCTTCTGTGTCA TGG Exonic