ID: 1170524872

View in Genome Browser
Species Human (GRCh38)
Location 20:17227368-17227390
Sequence TTTTGCATCTGCTGAGCGAC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 294}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170524868_1170524872 5 Left 1170524868 20:17227340-17227362 CCGCCGGGTTCCTCTTCTGTGTC 0: 1
1: 0
2: 0
3: 18
4: 195
Right 1170524872 20:17227368-17227390 TTTTGCATCTGCTGAGCGACCGG 0: 1
1: 0
2: 1
3: 21
4: 294
1170524867_1170524872 19 Left 1170524867 20:17227326-17227348 CCAGTGGAAGGCGGCCGCCGGGT 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1170524872 20:17227368-17227390 TTTTGCATCTGCTGAGCGACCGG 0: 1
1: 0
2: 1
3: 21
4: 294
1170524871_1170524872 -5 Left 1170524871 20:17227350-17227372 CCTCTTCTGTGTCATGGTTTTTG 0: 1
1: 1
2: 2
3: 39
4: 375
Right 1170524872 20:17227368-17227390 TTTTGCATCTGCTGAGCGACCGG 0: 1
1: 0
2: 1
3: 21
4: 294
1170524869_1170524872 2 Left 1170524869 20:17227343-17227365 CCGGGTTCCTCTTCTGTGTCATG 0: 1
1: 0
2: 2
3: 45
4: 408
Right 1170524872 20:17227368-17227390 TTTTGCATCTGCTGAGCGACCGG 0: 1
1: 0
2: 1
3: 21
4: 294
1170524865_1170524872 20 Left 1170524865 20:17227325-17227347 CCCAGTGGAAGGCGGCCGCCGGG 0: 1
1: 0
2: 2
3: 8
4: 92
Right 1170524872 20:17227368-17227390 TTTTGCATCTGCTGAGCGACCGG 0: 1
1: 0
2: 1
3: 21
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170524872 Original CRISPR TTTTGCATCTGCTGAGCGAC CGG Exonic