ID: 1170525010

View in Genome Browser
Species Human (GRCh38)
Location 20:17228142-17228164
Sequence CCTCTCCAGCTCCTGTAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 318}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170525010_1170525018 3 Left 1170525010 20:17228142-17228164 CCCGGCTACAGGAGCTGGAGAGG 0: 1
1: 0
2: 2
3: 42
4: 318
Right 1170525018 20:17228168-17228190 ATTTTGAGGGGGATTCCCTACGG 0: 1
1: 0
2: 0
3: 11
4: 98
1170525010_1170525016 -9 Left 1170525010 20:17228142-17228164 CCCGGCTACAGGAGCTGGAGAGG 0: 1
1: 0
2: 2
3: 42
4: 318
Right 1170525016 20:17228156-17228178 CTGGAGAGGTGGATTTTGAGGGG 0: 1
1: 0
2: 0
3: 35
4: 297
1170525010_1170525019 14 Left 1170525010 20:17228142-17228164 CCCGGCTACAGGAGCTGGAGAGG 0: 1
1: 0
2: 2
3: 42
4: 318
Right 1170525019 20:17228179-17228201 GATTCCCTACGGAGAAGTCGAGG 0: 1
1: 0
2: 0
3: 2
4: 25
1170525010_1170525017 -8 Left 1170525010 20:17228142-17228164 CCCGGCTACAGGAGCTGGAGAGG 0: 1
1: 0
2: 2
3: 42
4: 318
Right 1170525017 20:17228157-17228179 TGGAGAGGTGGATTTTGAGGGGG 0: 1
1: 0
2: 2
3: 37
4: 409
1170525010_1170525015 -10 Left 1170525010 20:17228142-17228164 CCCGGCTACAGGAGCTGGAGAGG 0: 1
1: 0
2: 2
3: 42
4: 318
Right 1170525015 20:17228155-17228177 GCTGGAGAGGTGGATTTTGAGGG 0: 1
1: 0
2: 5
3: 21
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170525010 Original CRISPR CCTCTCCAGCTCCTGTAGCC GGG (reversed) Intronic
900291251 1:1924448-1924470 CCTCTCCAGCACCCGGGGCCGGG - Exonic
900673966 1:3872543-3872565 CCTCTTCAGCACCTGGAACCTGG + Exonic
900945919 1:5831395-5831417 CCTCACCAGCTCCAGGAGCCAGG - Intergenic
901495530 1:9619255-9619277 CATCTGGAGCTCCTGAAGCCAGG + Intergenic
901513563 1:9730532-9730554 CCACTCCAGCTGCTGCTGCCGGG + Exonic
901963652 1:12848079-12848101 CCTCTCCTGCTACAGCAGCCCGG + Exonic
901984244 1:13061513-13061535 CCTCTCCTGCTACAGCAGCCCGG - Exonic
901991296 1:13116190-13116212 CCTCTCCTGCTACAGCAGCCCGG + Intergenic
901997567 1:13165257-13165279 CCTCTCCTGCTACAGCAGCCCGG + Exonic
902282198 1:15382865-15382887 CCTCTGCGGCTCCTTCAGCCGGG - Intronic
902884260 1:19393519-19393541 CCTCTCCACCTCGTGTTGGCTGG - Intronic
903377352 1:22875331-22875353 CCTCTCCAGGGTCTGTAGCAGGG - Intronic
904172154 1:28598952-28598974 CCTCTGCCTTTCCTGTAGCCTGG - Intronic
904627469 1:31815102-31815124 CCTCAGCAGCACCTGCAGCCCGG + Exonic
904810379 1:33159843-33159865 CGCCTCCAGCTCCTCTAGCATGG + Exonic
904852251 1:33467925-33467947 CAGCTTCAGCTCCTGTAGACTGG - Intergenic
906679380 1:47715049-47715071 CCTCTCCACTTCCTGGGGCCAGG - Intergenic
907297665 1:53465696-53465718 CCTCTCCAGCTACTGGATCTAGG - Intronic
907416076 1:54314849-54314871 CCTGTCCAGCGTCTGTACCCAGG - Intronic
908338996 1:63157082-63157104 CCTCTCCAGCTGCTGGAGGCTGG + Intergenic
910827723 1:91427727-91427749 CCACTCCAGAACCTGTTGCCTGG + Intergenic
911241678 1:95474671-95474693 CCTCCCTAGCTGCTGTAGCTGGG + Intergenic
912475406 1:109931478-109931500 CCTCTCCAGCTCCAGTAGGAAGG - Intergenic
913284557 1:117214628-117214650 CCTCTCCAGAGCCTGTGGTCTGG + Intergenic
914241779 1:145857573-145857595 CCTCTGAAGCTTCTGTGGCCAGG + Intronic
915551429 1:156637468-156637490 CCTCTGCTGCTCCAGTAGCTGGG + Intergenic
915963304 1:160284860-160284882 GCTCCCCAGCTCCAGTCGCCGGG + Intronic
916809857 1:168295911-168295933 ACTGTCCAGCACCTGCAGCCAGG - Intronic
919726473 1:200887926-200887948 CCTCTACAGCTCTTCTATCCTGG - Intergenic
919991827 1:202712619-202712641 CTCTTCCAGCTCCTGAAGCCTGG - Intergenic
920073136 1:203317557-203317579 CCTTTCCACCTACTTTAGCCAGG + Intergenic
920172562 1:204080861-204080883 CAACTCCAGCTTCTGTAGCTGGG + Intronic
920207210 1:204301195-204301217 CCTCTCTAGCTCCAGAAGACAGG + Intronic
920303264 1:205002542-205002564 GCTCTCCAGCTCCTGGTGCCTGG + Intronic
920377467 1:205516889-205516911 CTTCTCAAGCTCCTGGGGCCAGG - Intronic
921264431 1:213410630-213410652 ACTCCCCTGCTCCTGCAGCCAGG - Intergenic
921851982 1:219941033-219941055 CTTCTCTACCTCCTGTAGGCTGG - Intronic
922110008 1:222547471-222547493 CCTCTCATTCTCCTGGAGCCTGG + Intronic
922785948 1:228282296-228282318 CCCCACCAGCTTCTGTAGCCAGG - Intronic
924768559 1:247057330-247057352 CCTCTCCAGCAATTGTTGCCTGG - Intronic
1062817558 10:511918-511940 CTTCTCCAGCTGCTGCTGCCTGG + Intronic
1063278467 10:4597819-4597841 CCACACCAGATTCTGTAGCCTGG - Intergenic
1063380428 10:5582153-5582175 CCCGTCCAGCTCCTGCAGCCAGG + Intergenic
1063974707 10:11405975-11405997 CCTCTCCAGATCCACTAGCAGGG + Intergenic
1063976920 10:11424726-11424748 CCTCTCCAGCTTCTAAAGCTGGG + Intergenic
1064021610 10:11813723-11813745 CCTTCCCAGCTCCTGTCACCAGG + Intergenic
1064161141 10:12947648-12947670 TTTGTCCAGCTCCTGTTGCCTGG - Intronic
1064923409 10:20543199-20543221 CCTCTCCAGCACCTGTTGACTGG - Intergenic
1067427649 10:46221756-46221778 CCTCTGCACAGCCTGTAGCCAGG + Intergenic
1067479340 10:46585039-46585061 CTTCTGCAGCTCCTGTATTCTGG - Intronic
1067583071 10:47457669-47457691 CCTCTGCATAGCCTGTAGCCAGG + Intergenic
1067615399 10:47756762-47756784 CTTCTGCAGCTCCTGTATTCTGG + Intergenic
1068188588 10:53619775-53619797 CCTCTTCAGCTCCTGTATTGTGG - Intergenic
1069246898 10:66218018-66218040 CCTCTCCAGCTCCTGTGTGGTGG + Intronic
1069300411 10:66900219-66900241 CCACTCCAGCCCCTTTTGCCTGG - Intronic
1069389865 10:67923056-67923078 CCTCACCACCTCCTGTGGACTGG + Exonic
1069610972 10:69772336-69772358 TCTCTCCAGGCCCTGAAGCCAGG + Intergenic
1069824925 10:71249247-71249269 CCCCTCCAGAGCCTGCAGCCTGG + Intronic
1071630802 10:87216713-87216735 CCTCTGCAGCTCCTGTATTCTGG + Intergenic
1072664506 10:97384067-97384089 CCCCTCCACCTCCGGCAGCCAGG + Intronic
1073122775 10:101132355-101132377 CCTCTCCGGATCCACTAGCCGGG + Intronic
1073332787 10:102681605-102681627 CCTCTCCTCCTCCTGGAGACAGG - Intronic
1073416512 10:103387562-103387584 CATCTGTTGCTCCTGTAGCCAGG - Exonic
1074697984 10:116068029-116068051 CCTCTCAAGCTCATCTTGCCTGG + Intronic
1075451100 10:122552566-122552588 TCTCTCCAGCTTCTGTGCCCAGG + Intergenic
1075689654 10:124386657-124386679 CCTCACCTGTTCCTGTTGCCTGG - Intergenic
1076238979 10:128888020-128888042 CCTCTGCAGCCCATGGAGCCTGG - Intergenic
1076372745 10:129965349-129965371 GCGGCCCAGCTCCTGTAGCCGGG + Intergenic
1076499371 10:130924333-130924355 CCTCCCCAGGTCCTGCGGCCTGG - Intergenic
1076880071 10:133235738-133235760 CCTCCCCGCCTCCTGCAGCCCGG - Intergenic
1077021647 11:419704-419726 GGTCTCCAGCACCTGCAGCCAGG + Exonic
1077712609 11:4551870-4551892 CCTTTCTAGGTCCTGAAGCCTGG - Intergenic
1078660156 11:13278975-13278997 CCTCCCCAGCTCCTGCCGGCGGG - Intronic
1080333236 11:31166545-31166567 TCTCTCCAACTCCTATAGCGAGG - Intronic
1080768936 11:35322602-35322624 CCTCTCCAGATCCTGAAGCCTGG - Intronic
1081852740 11:46285101-46285123 CCTCTCCTGGTGCAGTAGCCAGG - Intronic
1084167692 11:67383669-67383691 CCTCCCAAGCTGCTGGAGCCTGG - Intronic
1084170088 11:67396840-67396862 GCTTTCCAGCTCCTGTCCCCTGG + Intronic
1084489750 11:69471816-69471838 CCCCTCCAGCTCCTGAAGGCCGG - Intergenic
1084630665 11:70346553-70346575 CCTCTGCAGCATCTGTTGCCAGG + Intronic
1084948252 11:72650602-72650624 CCCCTCCAGGTTCTGCAGCCTGG - Intronic
1085410405 11:76287429-76287451 CCTCTCCACCTCCTGGGGCAGGG + Intergenic
1086267752 11:85021443-85021465 CCTCTCCTGCTACAGCAGCCCGG + Intronic
1088558144 11:111083762-111083784 CCTCTTCAGCTCCTGTATCATGG - Intergenic
1088849929 11:113696159-113696181 CCTGTCCAGCTCCTGTGCTCAGG - Intronic
1089163490 11:116457475-116457497 CCTCACCAGCTTCTGGAGGCTGG + Intergenic
1089522802 11:119076833-119076855 CTTCTCCAGCTCATGTACACAGG - Intronic
1090636876 11:128694890-128694912 GCTCTCCAGCGCCTAGAGCCGGG - Intronic
1090815064 11:130285707-130285729 CCTCTCCAGTTCTTGTACTCTGG + Intronic
1090952192 11:131483593-131483615 CTTCTCCAGCTCCCCTTGCCAGG + Intronic
1091015853 11:132050240-132050262 CCTCTCCAGCTGCTTGACCCTGG - Intronic
1091037382 11:132246021-132246043 CCTCTCATTCTCCTCTAGCCCGG - Intronic
1091227695 11:133967420-133967442 GCTCCCCAGCGCCTGTAGCCCGG - Intergenic
1091270898 11:134311181-134311203 CCACTCCGCCTCCTGTGGCCAGG - Intronic
1091657036 12:2353512-2353534 CCTCTCCACCTCCTGCTGCAGGG - Intronic
1092117268 12:6018495-6018517 CCTCTCCAGCTCCTGCACGTTGG + Exonic
1093967693 12:25344952-25344974 CCTCCCCAGCTTCTCTAGGCAGG - Intergenic
1096626587 12:52899647-52899669 CCCCTCCAACTCCTGAACCCTGG + Intronic
1096684286 12:53277592-53277614 CCTCACCAGCATCTGCAGCCAGG - Exonic
1096866271 12:54565443-54565465 CCTTTCCAGCTCATTTAGCTGGG + Intronic
1099238463 12:80110900-80110922 CCTCTCCAGCATCTGTTTCCAGG + Intergenic
1100588542 12:96001890-96001912 GCTCTCCAGCTCCTCCAGCCCGG - Intronic
1103440891 12:120962157-120962179 CCTCTGCCCCTTCTGTAGCCAGG - Intergenic
1103723695 12:122987699-122987721 CCTCTCCACCCCCTGCACCCCGG + Intronic
1103914834 12:124370842-124370864 CCTCTCCAGCTGGGGTGGCCTGG - Intronic
1104920506 12:132288106-132288128 CGGCGCCAGCTCCTGGAGCCTGG + Intronic
1106406619 13:29480249-29480271 CTCCTCCAGCTCCTGGAGCTCGG - Exonic
1109050202 13:57470832-57470854 CTTCTCCATCTCCTGTGGGCTGG + Intergenic
1109865719 13:68260718-68260740 CCTCTCTCCCTCATGTAGCCCGG + Intergenic
1110890385 13:80690491-80690513 CCACTCCAGACCCTGTTGCCTGG - Intergenic
1111348433 13:86994545-86994567 CCTCTCCAGAGCCAGCAGCCTGG - Intergenic
1113561313 13:111283632-111283654 CCTTTCCAGCTCCTGGCCCCTGG - Intronic
1114285090 14:21233983-21234005 CCTCTCCTGCTACAGCAGCCCGG + Exonic
1116088370 14:40271162-40271184 CCTCTTCAGCCCCAGTAGCAGGG - Intergenic
1119757244 14:77127780-77127802 CCTCCCCACATCCTGTAACCTGG - Intronic
1119781460 14:77279000-77279022 CCTCTCCAGTTTCTGTAGCGTGG - Intronic
1120738227 14:88078956-88078978 CCTGGCCAGCTCCTGTGGCAAGG + Intergenic
1120834344 14:89027029-89027051 CTTCCCGAGCTCCTGTACCCAGG - Intergenic
1120963853 14:90150198-90150220 CCTCTCCAGCTTCTGTACCTCGG - Intronic
1121428653 14:93871947-93871969 CTGCTCCAGCTCCTTTTGCCAGG - Intergenic
1121511392 14:94515572-94515594 CGTCCCCAGCTCCTGGAGCAGGG - Intronic
1121674112 14:95738598-95738620 ATTCTCCATCTCCTGTATCCTGG - Intergenic
1122179718 14:99946430-99946452 CCTCCCCATCTCCTGCAGACGGG + Intergenic
1122211991 14:100179232-100179254 CCTCTTCAGCTCAGGCAGCCTGG + Intergenic
1122297530 14:100713760-100713782 TCTCTCCTGCTCCTGTACCGAGG - Intergenic
1122631366 14:103109153-103109175 CCTCTCCACCACCTGTCCCCCGG + Intronic
1123102709 14:105816412-105816434 CCCCTCCTGCTCCTTTTGCCTGG + Intergenic
1123717725 15:23042905-23042927 CCCCTCCAGCACCTCTGGCCAGG - Intergenic
1123718410 15:23045271-23045293 CCCCTCCAGCACCTCTGGCCAGG - Intergenic
1123718781 15:23046566-23046588 CCCCTCCAGCACCTCTGGCCAGG - Intergenic
1124862712 15:33458693-33458715 CCTATCTAGTCCCTGTAGCCAGG + Intronic
1125598581 15:40903097-40903119 CCTCTGCAGCTCCTCCAGCCGGG - Exonic
1125723490 15:41856470-41856492 CTTCTCCAGCTGCTGCACCCGGG + Exonic
1125827840 15:42691229-42691251 CTTCTCCACCACCTGAAGCCTGG - Exonic
1129053440 15:72801602-72801624 CTTGTGCAGCTCCTGCAGCCTGG + Intergenic
1129262604 15:74377153-74377175 CCACTCCACCTGCTGTGGCCAGG + Intergenic
1129912116 15:79236517-79236539 CCTCTCCTGCTCCAGCAGCCCGG - Intergenic
1130957967 15:88640328-88640350 CATCCCCAGCACCTGGAGCCTGG - Intronic
1131456927 15:92588863-92588885 CCTCACCAGCTGCTGTGGTCAGG + Intergenic
1132465687 16:76461-76483 CCTCTCCACCTCCTGGGGCAGGG + Intergenic
1132556457 16:574876-574898 CCCCTCCCACTCCTGCAGCCCGG + Intronic
1132685405 16:1159964-1159986 CTTCTGCAGCTCCAGGAGCCCGG - Intronic
1132692987 16:1189930-1189952 CTTCTCCAGCCCCTGGAGTCTGG - Intronic
1133326421 16:4944936-4944958 CCTCTCCTGCTCCAGCTGCCAGG - Intronic
1133392949 16:5423832-5423854 CTTCTCGAGCTCCAGTGGCCAGG + Intergenic
1134860517 16:17556284-17556306 CCTCTCCAAGTCATGCAGCCAGG - Intergenic
1135186653 16:20321634-20321656 CCTCTCCTGTTCCCTTAGCCTGG - Intronic
1135378653 16:21973955-21973977 CATCTCCAGCAGCTGTGGCCTGG - Exonic
1135971944 16:27078709-27078731 CAGCTCCAGCTGCTGTTGCCAGG - Intergenic
1138081285 16:54093590-54093612 CCTTTCCAGCTCCTGCAAACAGG - Intronic
1138119642 16:54389138-54389160 CCTCTTCAGCTCCCGCAGCTAGG + Intergenic
1138297199 16:55897121-55897143 CCTCTCCAGCTTGTGTCTCCAGG + Intronic
1138436225 16:57001509-57001531 TCTCTCCAGCCCCTGACGCCTGG - Intronic
1138447998 16:57076884-57076906 TCACTCCAGCTCCTCTAGGCTGG - Exonic
1138590293 16:57995954-57995976 CCTCTCCGTCTGCTCTAGCCAGG - Exonic
1138643394 16:58404575-58404597 CCTCTCCATCTCGTCTAGCCTGG - Exonic
1139852436 16:69959351-69959373 CCCCTTCAGCTCCTGCGGCCAGG - Intronic
1139881407 16:70182259-70182281 CCCCTTCAGCTCCTGCGGCCAGG - Intronic
1140124923 16:72111032-72111054 CTTCTCCTGCTCCTGCCGCCGGG - Exonic
1140371100 16:74413245-74413267 CCCCTTCAGCTCCTGCGGCCAGG + Intronic
1141532504 16:84656484-84656506 GCTCTCAAACTCCAGTAGCCGGG + Intronic
1141663289 16:85453149-85453171 CCTTTCCAGCTCCCGTATCGGGG + Intergenic
1141689211 16:85587058-85587080 CACCTCCATCTCTTGTAGCCTGG + Intergenic
1142151269 16:88513515-88513537 CCTCTACCTCTCCTGTGGCCAGG - Intronic
1143187770 17:5020802-5020824 ATTCTCCAGATCCTGCAGCCTGG - Exonic
1143272776 17:5688265-5688287 CGTCCCCAGCTCCTGAAGCCAGG - Intergenic
1143509753 17:7388914-7388936 CCTCTCCTGCCCCTGCCGCCTGG + Intronic
1143628462 17:8123897-8123919 CCTCTCCAGCTTCTGGCTCCTGG + Intronic
1144565983 17:16359738-16359760 CCTCAGCAGCCCCTGTAGCTGGG + Intergenic
1145185504 17:20790623-20790645 CCTCAGCATCTCCTGTAGCTAGG + Intergenic
1145996331 17:29106906-29106928 CTTCTCCAGCTCCTATGGTCTGG + Intronic
1146061557 17:29610308-29610330 CCTCCCCTGCTTCTGTAGTCTGG + Intronic
1146358991 17:32159210-32159232 CCTCTCCTGCTCCTGCTGCAGGG + Intronic
1146826931 17:36031246-36031268 CCTCTCCAGATCCTGAGGCTTGG - Intergenic
1147861084 17:43523868-43523890 CCTCTCCAGCAGCAGTAGCCAGG + Exonic
1148716158 17:49717629-49717651 CCCCTCCTCCTCCTGGAGCCTGG - Exonic
1148842779 17:50509323-50509345 CTTATCCAGCTCCTTTAGCCTGG + Intronic
1150284835 17:63948865-63948887 CCTCTCCAGCTCCCAGACCCAGG + Intronic
1150845212 17:68650001-68650023 CCTCTTCAGGTTCTGGAGCCTGG - Intergenic
1151380653 17:73723612-73723634 TCTGTCCAGATCCTGTATCCTGG - Intergenic
1151573356 17:74938314-74938336 CGTCTGAAGCTCCTGAAGCCTGG + Intronic
1151730478 17:75908286-75908308 CCTCTCCAGTGTCTGTGGCCTGG + Intronic
1152170554 17:78744214-78744236 CCTCTCCATCTCCTGCAGCAAGG - Intronic
1152261659 17:79270477-79270499 CCTCCCCTTCTCCTGTACCCAGG + Intronic
1152275696 17:79355478-79355500 CCTCTCCAGGTCCTGCTGCCTGG + Intronic
1152885214 17:82845444-82845466 CCTCTCCATCTCGTCTGGCCCGG + Intronic
1153313322 18:3699432-3699454 CCGCTCCAGATCCTGTTGCCTGG + Intronic
1153369217 18:4295004-4295026 CCTCATCTGCTCCTGGAGCCTGG + Intronic
1153704184 18:7728423-7728445 CCTCTTCAGCTCCTGTATGGTGG - Intronic
1154041514 18:10860419-10860441 CTTCTCCAGCTCCTAAGGCCCGG + Intronic
1158478615 18:57802442-57802464 CCTCCCCAGCTCCTGTGGCAGGG - Intronic
1161020389 19:2007888-2007910 CATATGCACCTCCTGTAGCCAGG + Intronic
1161775504 19:6260054-6260076 CCTCTAGAGCTCCTGTTGCCTGG - Intronic
1161809648 19:6464586-6464608 CCTCTCCTTCTCCTGTCCCCAGG + Exonic
1163145755 19:15378695-15378717 CTTCTCGAGCTCCTGCAGCCAGG + Intronic
1163312681 19:16523338-16523360 CCCCTCCAGCACTTGTCGCCTGG - Intronic
1165112210 19:33509071-33509093 CCTGTGCAGGTCCTGCAGCCAGG - Intronic
1165121388 19:33561104-33561126 CCCCTCCAGCTCCTTCAGCCTGG - Intergenic
1165338915 19:35196419-35196441 CCTTTCCTGCTCCTTCAGCCAGG + Intergenic
1166130050 19:40740600-40740622 CCCCTCCAGCACCCATAGCCAGG + Exonic
1166351881 19:42202854-42202876 CCTCGCCTGCTCCTATTGCCTGG - Intronic
1166714455 19:44957764-44957786 GCTAGCCTGCTCCTGTAGCCAGG + Intronic
1167076645 19:47254218-47254240 CCTCTCCTGCCCCTCTTGCCAGG + Intergenic
1167792869 19:51691830-51691852 CTTCTCCAGCTTCTGGACCCCGG - Intergenic
1168149285 19:54436187-54436209 CCACCCCAGCTCCTGCAGCCGGG + Intronic
925306443 2:2850602-2850624 CCTCTGCTGCTCCTGATGCCTGG + Intergenic
925860791 2:8173258-8173280 CCTCCCCAGCCCCAGCAGCCAGG - Intergenic
926149186 2:10415294-10415316 CCCCTCCAGCTCCCGCAGTCAGG - Intronic
927153014 2:20206330-20206352 TCTCTCCAGTTCCTGAGGCCGGG + Intronic
927624693 2:24702516-24702538 CTTCTACAGCTGCTGTAACCAGG + Intronic
928320908 2:30282256-30282278 CCTGCCCAGCTGCTGCAGCCGGG - Intronic
929390781 2:41466242-41466264 CCTCTCAAAGTCCTGGAGCCTGG + Intergenic
931491612 2:62754255-62754277 CCACTCCAGACCCTGTTGCCTGG + Intronic
932581489 2:72995174-72995196 CCTCTCACCCTCGTGTAGCCGGG + Intronic
932606736 2:73170392-73170414 ATTCTCCAGCTCCTGCACCCAGG + Intergenic
933409781 2:81910428-81910450 CCTCATCTGCTCCTGGAGCCTGG + Intergenic
933918413 2:87019767-87019789 CCTCCCCAGCTCCTGTCCCTAGG + Intronic
933925688 2:87090043-87090065 ATTCTCCAGCTCCTGCACCCAGG - Intergenic
934004583 2:87750146-87750168 CCTCCCCAGCTCCTGTCCCTAGG - Intronic
935767537 2:106384167-106384189 CCTCCCCAGCTCCTGTCCCTAGG - Intergenic
936166222 2:110122060-110122082 CCTCCCCAGCTCCTGCTCCCAGG - Intergenic
937127158 2:119482168-119482190 CCTCTCCAGTTCCCAGAGCCTGG - Intronic
937247459 2:120502925-120502947 CCCATCCAGCTCCTCTTGCCTGG + Intergenic
938097901 2:128475337-128475359 CCCCTCCAGCTGCCGTGGCCTGG + Intergenic
938397914 2:130964203-130964225 CGTGTCCCGCTCCTGGAGCCTGG + Intronic
938813367 2:134874096-134874118 CCTCTTCTGCTCCTGTCCCCTGG - Intronic
938935981 2:136127779-136127801 CCTCTTCACCTCCAGAAGCCAGG - Intergenic
941395032 2:164963781-164963803 CTCCTCCAGCTTCTGGAGCCAGG - Intergenic
942575822 2:177362502-177362524 CCTCTCCATCCACTGTACCCTGG + Intronic
943601235 2:189923524-189923546 CCTCTCCTGCTACAGCAGCCCGG - Intronic
944510804 2:200463838-200463860 CTTCTCCAGCTCCTGGCCCCTGG + Intronic
946405172 2:219488634-219488656 CATCACCAGCTCCTGTACCGTGG + Exonic
946481282 2:220059220-220059242 CCTCCTCAGCACCTGTAGCTAGG + Intergenic
947473405 2:230418507-230418529 GCTTTACAGCTCCTCTAGCCAGG + Intronic
948074723 2:235156861-235156883 CCTCTCCTCCCCCTGTGGCCAGG + Intergenic
948943434 2:241207643-241207665 GCTCTCCAGCGCCTGTGCCCTGG + Exonic
1170525010 20:17228142-17228164 CCTCTCCAGCTCCTGTAGCCGGG - Intronic
1172483500 20:35285305-35285327 TCTCTCCAGCACCTGCAGCCTGG - Intergenic
1174379598 20:50148176-50148198 CCTCACCACCTCCTGGAGCTAGG + Intronic
1175714724 20:61247728-61247750 CCTCCCCATCTTCTGTTGCCAGG + Intergenic
1175755262 20:61525547-61525569 CCCCTCCAGCTGCAGAAGCCGGG + Intronic
1175884820 20:62283793-62283815 CCTTCCCATCTCCTGCAGCCCGG + Intronic
1178914240 21:36698126-36698148 CCTGTCCGGCTCCCGCAGCCTGG - Intergenic
1179176348 21:39010776-39010798 TCCCTCCAGCTCCCCTAGCCAGG + Intergenic
1179955398 21:44735456-44735478 CCTCTCCAGCCCTGGCAGCCAGG + Intergenic
1180231747 21:46430542-46430564 ACTCTCCAGCTCCTGAAGCGCGG - Exonic
1180568702 22:16696908-16696930 CCTCTCCAGCTCCTGAACGTTGG + Intergenic
1181349765 22:22246599-22246621 GCACTCCAGCTCCTGTCTCCAGG + Intergenic
1181980312 22:26761428-26761450 CCTGACCACCTCCTGTAGGCCGG + Intergenic
1182620730 22:31617105-31617127 CAACACCTGCTCCTGTAGCCAGG - Intronic
1183157797 22:36088609-36088631 TCACTCCTGCTCCTGTGGCCGGG - Intergenic
1183202848 22:36397761-36397783 CCTCTCTGGATCCTGCAGCCTGG + Intergenic
1183383154 22:37500519-37500541 CCTTCTCAGCTCCTGGAGCCTGG - Intronic
1184420695 22:44381331-44381353 CCTCCTCAGCTCCTGTTGCCAGG - Intergenic
1184692173 22:46122418-46122440 CCTGTCCAGCGCCTGCAGCTGGG - Intergenic
1184979315 22:48084885-48084907 CCTCTGCAGCTGCAGCAGCCAGG - Intergenic
1185065689 22:48630758-48630780 CTTCCCCAGCGCCTGGAGCCTGG - Intronic
1185368056 22:50445968-50445990 CCTCACCAGCCCCTCTGGCCAGG + Exonic
950181276 3:10915181-10915203 CCTCTTCAACTCCAGTAGCTGGG - Intronic
951318518 3:21216671-21216693 AGTCTCCAGAACCTGTAGCCAGG - Intergenic
953147609 3:40293159-40293181 CCTCTCCAGCCCCTGAATCATGG - Intergenic
953612049 3:44455145-44455167 CCTCTGCAGCTCCTCCAGCAAGG + Exonic
953832314 3:46310905-46310927 CATCTCCAGCAGCTGCAGCCTGG + Intergenic
953843057 3:46405540-46405562 TCTCTCCACCTCCTGCAGCTGGG - Intergenic
953899872 3:46833927-46833949 CCGCTTCAGGTCCTGGAGCCGGG + Exonic
954107996 3:48419571-48419593 CCTCACCAGCTCCCAGAGCCCGG + Exonic
954439956 3:50516413-50516435 GCTCTGCTGCCCCTGTAGCCTGG + Intergenic
954539441 3:51384236-51384258 CCTCTCCAACCCTTGTCGCCGGG + Intergenic
956425551 3:69130711-69130733 CCTCTCCAGCACCTGTTGTTTGG + Intergenic
959520032 3:107315276-107315298 CTTCTCCAGCTTCTCTAGCAAGG + Intergenic
961622999 3:128239456-128239478 CCTCTTGACCTCCTGGAGCCTGG - Intronic
961819462 3:129567884-129567906 CCGCTCCAGCTCCTCTGGGCAGG + Intronic
962027268 3:131561289-131561311 CTTCTCCAGCTCCTGTATCCTGG - Intronic
962145205 3:132833313-132833335 CCTCTCCACCTCCTGGGTCCAGG - Intergenic
964332691 3:155621110-155621132 CCACTCCAGACCCTGTTGCCTGG - Intronic
965476162 3:169158075-169158097 CCTCGCCAGCTCTTGTAGAATGG - Intronic
967794142 3:193580177-193580199 CCTCTCCTGCTGATATAGCCTGG + Intronic
968494859 4:909997-910019 GCCCTCCAGCGCCTGTTGCCAGG - Intronic
968511635 4:998193-998215 CCCCACCTGCTCCTGTACCCCGG - Intronic
968947618 4:3673857-3673879 CCTCTCCACTTCCCGTAGGCTGG - Intergenic
969613089 4:8237798-8237820 CCTTGCCAGCTCCTCCAGCCGGG - Intronic
971460373 4:26889660-26889682 CCTCATTAGCACCTGTAGCCAGG + Intronic
976327364 4:83787189-83787211 CTTCTCTAACTGCTGTAGCCTGG + Intergenic
978605733 4:110476839-110476861 CCTCTTCAGCTCCGGGAGCCGGG - Exonic
981243366 4:142505674-142505696 CCTTTCCATCTCCTCTAACCAGG - Intronic
983546128 4:168966550-168966572 CCTCTCCAGCATCTGTTTCCTGG - Intronic
983781406 4:171674506-171674528 CGTCTCCTGCTTCTGGAGCCTGG - Intergenic
983852949 4:172605919-172605941 CCTCTTCAGCTCCTGTATGGTGG - Intronic
985315965 4:188659226-188659248 CCTGCCCAGCGCCTGCAGCCCGG - Intergenic
985672123 5:1212502-1212524 CCTCTGGAGCACCTGCAGCCTGG - Intronic
986305450 5:6510909-6510931 CCTCCCCAGCTCCATTTGCCAGG + Intergenic
987251726 5:16107727-16107749 CCTCATCTGCTCCTGGAGCCTGG - Intronic
988788911 5:34589463-34589485 CCAGTCCAGCTCCTGTCACCAGG - Intergenic
991389682 5:66129156-66129178 CATGTCCAGCTGCTGCAGCCAGG + Intergenic
991973979 5:72168043-72168065 CCTGTCCAGCTCCTGTCGCTTGG + Intronic
993496191 5:88611721-88611743 CCTCACCAGATGCTGCAGCCTGG + Intergenic
994486459 5:100390101-100390123 CCTCTACAGCTCCTGTGTCTGGG + Intergenic
996536774 5:124585703-124585725 CCTCATCAGCTTCTGGAGCCTGG + Intergenic
998165168 5:139838606-139838628 CCTCTCCCCCTCCTGTCCCCAGG + Exonic
999738505 5:154531185-154531207 CCTCTGCAGCTCCTGTCTTCTGG - Intergenic
999811478 5:155131504-155131526 CCTCTCCTGCTTCTGGAGCCTGG + Intergenic
1002296680 5:178235243-178235265 TCTCTCCTGCTCCTTTAGGCAGG - Intergenic
1002966123 6:1968428-1968450 ACATTCCAGCTCCTGAAGCCAGG + Intronic
1005814463 6:29539484-29539506 CTTCTCCAGCTCCTGGAACAGGG + Intergenic
1006248115 6:32757933-32757955 CATCTCCACCTCCTGTACCAAGG - Intronic
1006899791 6:37492683-37492705 CATCTCCAGCCCCAGCAGCCTGG + Intronic
1007076065 6:39066886-39066908 CCTCTCCTGCTCTTGCTGCCTGG - Intronic
1007771326 6:44194589-44194611 CCTCTCCAGCCCCCGTAGGCAGG - Intergenic
1008015488 6:46513839-46513861 CCTCTCTAGCTTCTGAGGCCTGG - Intergenic
1011387582 6:86814927-86814949 CCACTCCAGATCCTGTTGCCGGG + Intergenic
1012297920 6:97547631-97547653 CCACCCCAGCTGATGTAGCCTGG - Intergenic
1012972698 6:105748744-105748766 CTTCTCCATCTCCTGGAGGCTGG + Intergenic
1015291178 6:131539413-131539435 CCACTCCAGACCCTGTTGCCTGG - Intergenic
1018108141 6:160508462-160508484 CCTCTCCAGCTCATGTCGCTAGG + Intergenic
1018123768 6:160662042-160662064 CCTCCCCAGCTCATGTTGCTAGG + Intronic
1018312466 6:162525290-162525312 CATCTCCAGCTGCTGTCCCCTGG + Intronic
1019600392 7:1880369-1880391 GCTCCCCAGCTCCTCTAACCAGG - Intronic
1020261158 7:6531417-6531439 CCTCTCCAGCTACTGCGCCCCGG + Intronic
1020280567 7:6648044-6648066 GCTCTCCAGCTTCTGTCCCCAGG - Intronic
1020409601 7:7876303-7876325 CATCTCCAGCTCGTGTGCCCTGG - Intronic
1022344523 7:29501444-29501466 CCTCTCCAGAGCCTGCAGTCAGG + Intronic
1023018060 7:35985393-35985415 CCTCTGCAGCTGCTGAAGCCAGG - Intergenic
1023273833 7:38496426-38496448 TCTCTTCAGCTCATGTAGGCAGG - Intronic
1023849109 7:44140504-44140526 CCCCTCCAGCCCCTGTGGCCAGG - Intronic
1024425140 7:49216374-49216396 CCACTCCAAGTCCTGGAGCCAGG - Intergenic
1029476821 7:100790000-100790022 CCTCTCCAGTTCCAGAAGCTGGG - Intronic
1029490779 7:100868762-100868784 TCTCTCTGGCTCCTATAGCCAGG - Exonic
1031017012 7:116586055-116586077 GCTCTCCAAGTCCTGTAACCTGG - Intergenic
1032517777 7:132519618-132519640 CCTCTCTAGCTGCTCTGGCCTGG + Intronic
1032745260 7:134779824-134779846 CATCTCCAGCTACCTTAGCCAGG - Intronic
1033756557 7:144401553-144401575 CCTCCCCGGGTCCTGCAGCCAGG + Exonic
1034196229 7:149250313-149250335 CCCCTCCAGGCTCTGTAGCCGGG - Exonic
1034944573 7:155253644-155253666 CCTCTCCAGGTCCCACAGCCAGG - Intergenic
1038670765 8:29581107-29581129 CCTCTCCATTTCCTGAAGCTGGG + Intergenic
1039120568 8:34141924-34141946 CCTCTGCTGCCCCTGTAGCTGGG + Intergenic
1041078605 8:54191884-54191906 GCTCTCCTGCTCCTGCACCCCGG - Intergenic
1044502725 8:92978241-92978263 CCTCTCCATGTGCTGTGGCCTGG + Intronic
1046417126 8:113932114-113932136 CCTCTCCAGCTCCTGTTTTCCGG - Intergenic
1046541684 8:115591648-115591670 GCTCTCCAGCACCTGTACCATGG - Intronic
1048939321 8:139384630-139384652 CCTCTGCAGCTCCTCTAGGCAGG + Intergenic
1049278552 8:141732233-141732255 CCTGCCCCGCCCCTGTAGCCTGG + Intergenic
1049341979 8:142118088-142118110 CCCTTCCAGCTTCTGGAGCCTGG - Intergenic
1049364136 8:142228446-142228468 CTTCACCAGCTCCTGTAGGCAGG - Intronic
1049788108 8:144460930-144460952 ACTCTCCAGCTCCTTTTTCCTGG - Intronic
1050393141 9:5167680-5167702 CCTCTCCAGAGCCAGTAGGCAGG - Intronic
1050602373 9:7265900-7265922 CCTCACCCTCCCCTGTAGCCAGG - Intergenic
1052390088 9:27869608-27869630 CCACTCCTCCTTCTGTAGCCAGG - Intergenic
1052940289 9:34127075-34127097 CCTGTCCAGCCCTTGGAGCCAGG - Intronic
1056873729 9:90307709-90307731 CCTCAGCTGCTCCTATAGCCTGG - Intergenic
1057439962 9:95075949-95075971 GCTCTCCCGCTCCTGCAGGCTGG + Intronic
1057909320 9:99005460-99005482 ACTGTCCAGCTCCTGAAGGCAGG + Intronic
1061161272 9:128895751-128895773 CCTCTGCTGCTCCGGTAACCTGG + Intronic
1061835750 9:133328391-133328413 CCTCTTCAGTCTCTGTAGCCAGG + Intergenic
1061950728 9:133934555-133934577 CCTCTCCCTCTCCTGGAGCTGGG + Intronic
1062020045 9:134315077-134315099 CCACTCCAGATCCAGTAGCAGGG - Intergenic
1062277087 9:135736297-135736319 CCTCTCCAGCATCTGCCGCCCGG + Intronic
1185612079 X:1398769-1398791 CCTCTCCAGCCCCTGCCACCCGG - Intergenic
1185632467 X:1525026-1525048 CCTCTCATAGTCCTGTAGCCAGG + Intronic
1186428978 X:9488351-9488373 CTTTTCCAGCTCCTGGAGACTGG + Intronic
1190227657 X:48558811-48558833 CCTCTCCTTCTACTGAAGCCGGG - Intronic
1191828202 X:65388900-65388922 CCACTCCAGATCCTGTTTCCTGG + Intronic
1199975726 X:152893951-152893973 CATCTGCCACTCCTGTAGCCTGG - Intergenic
1200367890 X:155686940-155686962 CCTTTCCTGCTCCTTGAGCCAGG + Intergenic