ID: 1170525127

View in Genome Browser
Species Human (GRCh38)
Location 20:17228712-17228734
Sequence CCTCTCTCCCAGCCACCGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170525121_1170525127 -10 Left 1170525121 20:17228699-17228721 CCCAAGCCTCCCGCCTCTCTCCC 0: 1
1: 2
2: 2
3: 56
4: 630
Right 1170525127 20:17228712-17228734 CCTCTCTCCCAGCCACCGCCAGG No data
1170525119_1170525127 24 Left 1170525119 20:17228665-17228687 CCGAAGCTCTTATTAGTCTCTTC 0: 1
1: 0
2: 0
3: 15
4: 192
Right 1170525127 20:17228712-17228734 CCTCTCTCCCAGCCACCGCCAGG No data
1170525120_1170525127 -2 Left 1170525120 20:17228691-17228713 CCTGACTTCCCAAGCCTCCCGCC 0: 1
1: 0
2: 3
3: 22
4: 437
Right 1170525127 20:17228712-17228734 CCTCTCTCCCAGCCACCGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170525127 Original CRISPR CCTCTCTCCCAGCCACCGCC AGG Intronic
No off target data available for this crispr