ID: 1170532278

View in Genome Browser
Species Human (GRCh38)
Location 20:17306421-17306443
Sequence CTCAAACAGAAGATGGTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170532275_1170532278 -1 Left 1170532275 20:17306399-17306421 CCCAAAGAGGATTGTTTGAATTC 0: 1
1: 0
2: 2
3: 17
4: 222
Right 1170532278 20:17306421-17306443 CTCAAACAGAAGATGGTCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 151
1170532276_1170532278 -2 Left 1170532276 20:17306400-17306422 CCAAAGAGGATTGTTTGAATTCT 0: 1
1: 0
2: 10
3: 29
4: 278
Right 1170532278 20:17306421-17306443 CTCAAACAGAAGATGGTCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170532278 Original CRISPR CTCAAACAGAAGATGGTCCC AGG Intronic
906816714 1:48887120-48887142 CTCACACAGAAGATTCTGCCAGG - Intronic
907483953 1:54764166-54764188 CTCAGGCAGCAGGTGGTCCCAGG + Intronic
908183537 1:61629440-61629462 CTGATACAGAAAATGGTACCAGG + Intergenic
910977199 1:92919112-92919134 ATGAAAAAGAAGATGCTCCCTGG - Intronic
912055846 1:105597162-105597184 TGCACACAGCAGATGGTCCCTGG - Intergenic
912544073 1:110438416-110438438 CTGAAACCAAAGATGGGCCCAGG + Intergenic
913118643 1:115719531-115719553 CCCAGACCCAAGATGGTCCCTGG + Intronic
914239930 1:145846500-145846522 CCCACACCCAAGATGGTCCCAGG - Intronic
917068740 1:171126053-171126075 CTGATACAGAAGTTGGTGCCAGG - Intergenic
917224745 1:172769441-172769463 CTCAAATAAAAAATGGTCACAGG + Intergenic
918719729 1:187837893-187837915 CTCTCATAGAAGACGGTCCCTGG - Intergenic
920432878 1:205929887-205929909 CTCACAAAGACGATGGACCCTGG + Exonic
920938282 1:210456430-210456452 CTCAAAAAGGGGGTGGTCCCAGG - Intronic
921486994 1:215726750-215726772 CTCAAACTGAAGATGCTTCATGG - Intronic
922593954 1:226799334-226799356 CTCAGACAGAAGAGGCTCCCAGG - Intergenic
1065439790 10:25739711-25739733 CACATACAGAATATTGTCCCTGG + Intergenic
1065553314 10:26890428-26890450 CTCAACCACAAGCTGGGCCCTGG + Intergenic
1065599808 10:27356888-27356910 CTCAACCACAAGCTGGGCCCTGG - Intergenic
1066302709 10:34110934-34110956 CTCAAACAGATGATTGTCACAGG + Exonic
1068907267 10:62340587-62340609 TTCCAACAAAAGATGGTACCTGG + Intergenic
1072573065 10:96675364-96675386 TTCAAACAGAAGTTGGCCACTGG + Intronic
1075390440 10:122087326-122087348 CACATGGAGAAGATGGTCCCGGG + Exonic
1075621591 10:123932213-123932235 TACACACAGAAGATGGTGCCTGG - Intronic
1076295773 10:129383191-129383213 CACAAAGAGAAGATGCTCCCAGG + Intergenic
1076414522 10:130276262-130276284 GTCAGACAGATGATGCTCCCCGG + Intergenic
1077546195 11:3171069-3171091 CTCACTCAGACGATGCTCCCTGG + Intergenic
1078535227 11:12167630-12167652 ATAAAGCAGAAGATGGTCCCTGG + Intronic
1084936569 11:72590123-72590145 CTCAAGGGGAAGTTGGTCCCCGG + Intronic
1090008809 11:123027471-123027493 CTCAAACAAAAAAAGGTGCCTGG + Intergenic
1090650001 11:128798366-128798388 ATGAAATAGAAGAAGGTCCCAGG + Intronic
1102297633 12:111749211-111749233 CCCAAAGAGAACATGGTCCTGGG + Exonic
1103847104 12:123909156-123909178 CTCAACCAAAAGACAGTCCCTGG - Intronic
1105889117 13:24669379-24669401 CTCACAGAGAAGAAGGTGCCAGG - Intergenic
1106563325 13:30864838-30864860 CTCAGACTGGAGATGATCCCAGG - Intergenic
1108826964 13:54423881-54423903 CTCAAATAAGAGATGGCCCCAGG - Intergenic
1109856021 13:68129058-68129080 TTCAAGCTGAAGATAGTCCCAGG - Intergenic
1111338869 13:86857469-86857491 CTCCAACAAAACATGGTCACAGG - Intergenic
1120939653 14:89935079-89935101 TTCAAACAGGAGATGATGCCTGG - Intronic
1124121917 15:26895025-26895047 CTCAAACAGGAGCTGCTGCCTGG + Intronic
1125796682 15:42408845-42408867 CCCAGACAGAAGAGGGGCCCTGG - Intronic
1125930494 15:43596202-43596224 ATCAAACAGAAAGTGGTCCTGGG - Exonic
1125943662 15:43696034-43696056 ATCAAACAGAAAGTGGTCCTGGG - Exonic
1126512694 15:49498440-49498462 TTCAAACTGAAGATTTTCCCAGG + Intronic
1132094019 15:98968836-98968858 CTCAGAAAGAACATGGTGCCAGG + Intronic
1133440751 16:5819066-5819088 CTCAAACAGAATATGATACCAGG - Intergenic
1133966693 16:10536915-10536937 TTAAACCAGAGGATGGTCCCAGG + Intronic
1134732398 16:16473307-16473329 GCTCAACAGAAGATGGTCCCTGG - Intergenic
1134935040 16:18238657-18238679 GCTCAACAGAAGATGGTCCCTGG + Intergenic
1138685957 16:58726087-58726109 CTAACACAGAACATGTTCCCAGG + Intronic
1138884091 16:61054063-61054085 CTCATTCAGAAGATGGGGCCTGG + Intergenic
1139291272 16:65860121-65860143 CACATACAGAAGATGGATCCAGG + Intergenic
1139558185 16:67725876-67725898 CTCAAAGAAAACATGGTGCCTGG + Exonic
1141011881 16:80408784-80408806 CTCAAACAACAAATGGTTCCTGG + Intergenic
1141367640 16:83457971-83457993 CAGAAACAAAAGAGGGTCCCGGG + Intronic
1141508772 16:84499071-84499093 CTCAAACAGATGAGGCTCACGGG - Intronic
1142002667 16:87672308-87672330 CCCAGAAACAAGATGGTCCCAGG + Intronic
1142192412 16:88723940-88723962 CTCAAACAGGAAGTAGTCCCCGG + Exonic
1145070459 17:19801276-19801298 CTCAAAAAGAAGTTGGGGCCGGG + Intronic
1146421709 17:32692747-32692769 CCCAAACTGAGGATGGTTCCTGG + Intronic
1146505980 17:33405829-33405851 CAGAAACAGAAGATGGTTCAGGG - Intronic
1148746931 17:49923803-49923825 CTGAAAGAGAGGGTGGTCCCTGG - Intergenic
1148769838 17:50060367-50060389 CTCAAAGAGGAGAAGGCCCCTGG - Intronic
1150418487 17:65007061-65007083 CTCAAAAAGCAGATGGCCCAGGG - Intergenic
1158575216 18:58631481-58631503 CACAAACAGAACATGATCCAGGG + Intergenic
1159485925 18:69057212-69057234 CTGAAACAGAAATTGGTACCAGG - Intergenic
1160297010 18:77648010-77648032 CTCAAACAGCTGAGGGTCCCTGG - Intergenic
1165007451 19:32818438-32818460 CTTGAACAGAAGATGGTTCGTGG + Intronic
1166594939 19:44037899-44037921 CTCAACCAAAAGATGTTCACTGG + Intergenic
1168192767 19:54751831-54751853 CTCACAGACAGGATGGTCCCTGG + Intronic
1168197103 19:54783101-54783123 CTCACAAACAGGATGGTCCCTGG + Intronic
930510180 2:52334909-52334931 CTCTAAAAGAAATTGGTCCCTGG + Intergenic
932257180 2:70297958-70297980 CTCAAACAGAAGATGGCACCAGG + Intronic
935473229 2:103484941-103484963 CTGAAACAGAAAATGGAGCCTGG + Intergenic
937810430 2:126193824-126193846 CTGAAACAGAAGTTGATCACTGG + Intergenic
940242487 2:151578377-151578399 CTTAAACAGAAGAATGTCCATGG - Intronic
940243479 2:151589055-151589077 CTTAAACAGAAGAATGTCCATGG - Intronic
940244435 2:151599608-151599630 CTTAAACAGAAGAATGTCCATGG - Intronic
942053453 2:172162263-172162285 CTCAAGCAGAAGATGGAGACAGG - Intergenic
942185245 2:173419019-173419041 ATTAGACAGAAGGTGGTCCCTGG + Intergenic
942807471 2:179949169-179949191 CTGAATCAGCAGATGCTCCCAGG - Intronic
948781459 2:240324230-240324252 CTCAAACAGCAGTGGGGCCCGGG + Intergenic
1169118951 20:3084095-3084117 CCCACACAGAAGATGGCCACTGG - Intronic
1170532278 20:17306421-17306443 CTCAAACAGAAGATGGTCCCAGG + Intronic
1174778001 20:53363251-53363273 CTGATGCAGAAGATGATCCCAGG - Intronic
1175762517 20:61571233-61571255 CTGAAACAGAATTTGGACCCTGG + Intronic
1177558440 21:22719939-22719961 AACAAACAGAAGATGGTGCCTGG + Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1178483533 21:33002239-33002261 CAGAAACAGAAGATGAGCCCAGG + Intergenic
1178497439 21:33099246-33099268 CTGAAACAGCAGAAGGGCCCAGG + Intergenic
1181712800 22:24701407-24701429 CTGAAAAAGAAGGTGGTCACAGG - Intergenic
1182934879 22:34211324-34211346 CTTAAAAAGATGATTGTCCCAGG + Intergenic
1183206975 22:36426368-36426390 CTCAGAGAGAAGAGGCTCCCTGG + Intergenic
1184860593 22:47171373-47171395 CCCAAACAGAAGCTGGATCCAGG - Intronic
1184877662 22:47285755-47285777 CAGAAACAGATGATGGTCGCCGG - Intergenic
1185298563 22:50067031-50067053 CTCACTCAGGAGATGGCCCCTGG + Intronic
954673700 3:52304126-52304148 ATGAAACAGATGAAGGTCCCTGG + Intergenic
954894234 3:53962436-53962458 CTCAAGCAGAACATGGTTCCTGG - Intergenic
957806151 3:85152120-85152142 ATAATACAGAAAATGGTCCCTGG - Intronic
959650560 3:108746475-108746497 CACAAACTGGAGATTGTCCCAGG - Intronic
959869466 3:111310126-111310148 CTCAAATAGAAGAAGAACCCTGG - Intronic
960620988 3:119636527-119636549 CAGAAACAGAAGATGGTGACTGG + Intronic
965571597 3:170178877-170178899 TTGACACAGAAGATGTTCCCGGG + Exonic
966942565 3:184756221-184756243 CTAAGACAGAGGATGGGCCCCGG - Intergenic
967388119 3:188929878-188929900 CTCCCCCAGAAGATGGGCCCAGG + Intergenic
969530697 4:7728719-7728741 TGCAAACAGCAGGTGGTCCCTGG - Intronic
972423310 4:38910393-38910415 CTCACACAGGAGCTCGTCCCAGG + Intronic
974743719 4:66042321-66042343 CTCAAACAAAAAATGGGCCATGG + Intergenic
976315070 4:83651416-83651438 CCCAAACTGAGGATGCTCCCAGG + Intergenic
976840590 4:89428252-89428274 TTCAAACACAAGATGGTAGCAGG + Intergenic
977115824 4:93026359-93026381 TTCAAACAGAAATTGTTCCCTGG - Intronic
977741208 4:100485691-100485713 ATCAAAAAGAAGTTGGTGCCAGG - Intronic
982542783 4:156695415-156695437 CTCAGACTGAAGATGGGCACAGG - Intergenic
984186008 4:176544702-176544724 CTCACAAAGAAAATGGTACCCGG + Intergenic
984224244 4:177015382-177015404 ATCAAACAAAATATGGTCCCAGG - Intergenic
985162735 4:187061429-187061451 CTCAAACTAGAGATGCTCCCTGG - Intergenic
986493579 5:8319051-8319073 CTCACACAGAACCTGGGCCCAGG + Intergenic
987123333 5:14788399-14788421 CTCAACCAAGAGATGGTGCCAGG - Intronic
988966392 5:36422582-36422604 CTCAAAGAGACCACGGTCCCTGG - Intergenic
992137660 5:73763564-73763586 CCCAAACAGAACAGGGTCCCTGG + Intronic
992204225 5:74414508-74414530 CTCACACAGAATGTGGGCCCTGG + Intergenic
992905957 5:81345931-81345953 CTCCAACTGTAGATGGTCCCCGG + Exonic
993089065 5:83401167-83401189 CTCAAACATAAGAAGGACCTGGG - Intergenic
998497213 5:142601344-142601366 CTGAGACAGAAGAGGTTCCCAGG + Intronic
999889417 5:155960405-155960427 CTCAAACAGAAGACTGGCCTGGG - Intronic
1000380511 5:160624915-160624937 GACAAACACTAGATGGTCCCTGG - Intronic
1001085626 5:168698366-168698388 CTCTAAAAGAAGATGGTCATGGG + Intronic
1002405621 5:179027876-179027898 GACAACCAGGAGATGGTCCCAGG - Intronic
1005909360 6:30294558-30294580 CAGACACAGAAGATGCTCCCGGG - Intergenic
1006270604 6:32964022-32964044 CTAGAACAGGAGATGGTTCCAGG - Intronic
1007112730 6:39322391-39322413 CTCCAACTGAAACTGGTCCCTGG + Exonic
1008188993 6:48431428-48431450 CTGAAACAGATGTTGGTACCTGG + Intergenic
1009425617 6:63510592-63510614 CTGACACTGAAGATGGTGCCTGG - Intergenic
1011657568 6:89565610-89565632 TTCAAACAGGATATGGTCCAGGG + Intronic
1012472997 6:99591259-99591281 CCCCAACAGAAGAGGGACCCCGG + Intergenic
1012580132 6:100857905-100857927 CTCAAACATAAGACTGTGCCTGG + Intronic
1015756574 6:136612809-136612831 GTTAAACAGGAGATGGCCCCTGG - Intronic
1015882246 6:137881161-137881183 CCCAACCAGAGGATGGGCCCTGG + Exonic
1023486816 7:40696396-40696418 CCCAAACATAAGATGGGGCCTGG - Intronic
1024337562 7:48224884-48224906 CTTATTCAGGAGATGGTCCCAGG - Intronic
1024867095 7:53915592-53915614 GTAAAACAGAGGATGGTGCCTGG + Intergenic
1025766533 7:64459550-64459572 CTCAAACAGAAGATTTTACATGG - Intergenic
1029747604 7:102525185-102525207 CTGAGACTGGAGATGGTCCCAGG + Intergenic
1029765555 7:102624275-102624297 CTGAGACTGGAGATGGTCCCAGG + Exonic
1032954164 7:136951122-136951144 CTCAAACAGAGGAGGCCCCCTGG + Intronic
1033622035 7:143070211-143070233 CCCAAACTGAGGATGGTCCTGGG - Intergenic
1035096685 7:156361592-156361614 CACAAACACAAGCTGGTGCCTGG - Intergenic
1038257796 8:25966648-25966670 CTCAAAGAGGAGATGGGCCAAGG - Intronic
1038670695 8:29580728-29580750 CTCAAAGGAAAGATGGTCCATGG - Intergenic
1047366340 8:124215219-124215241 ATCAAAAAGAAACTGGTCCCTGG + Intergenic
1047577254 8:126170784-126170806 CTCATCCAGGAGATGGTGCCTGG - Intergenic
1052145977 9:25050016-25050038 CTCAAAAAGATGATGCTTCCAGG - Intergenic
1056786559 9:89596826-89596848 CTCAAACAGAAGTTTGTAGCTGG - Intergenic
1058027867 9:100162004-100162026 CTCACACAGAAGATAGAGCCTGG + Intronic
1059642054 9:116226993-116227015 CTAAAACACAAGATGGTGTCTGG + Intronic
1061299834 9:129698061-129698083 CTTAACCACAAGGTGGTCCCTGG + Intronic
1061538055 9:131261553-131261575 CTCAGACAGAAGAAGGTGGCCGG + Intronic
1185789830 X:2920305-2920327 CTGAATCAGAAGTTGGTGCCTGG - Intronic
1187423581 X:19157904-19157926 GTCAAACAGAAATTGTTCCCTGG - Intergenic
1188311814 X:28626537-28626559 CTAAGACAGGAGATGGTCCTTGG - Intronic
1195374618 X:104214694-104214716 CCCAAAAACAAGATGGTCCTAGG + Intergenic
1195676635 X:107511840-107511862 CTAAGCCAGAAGAGGGTCCCCGG - Intergenic
1196053835 X:111333878-111333900 CACAAAGAGATGAGGGTCCCTGG + Intronic
1196619161 X:117802726-117802748 CTAAAACAGAACATTGTCACAGG + Intergenic
1201929787 Y:19329968-19329990 CTACAGCAGAAAATGGTCCCAGG + Intergenic