ID: 1170536823

View in Genome Browser
Species Human (GRCh38)
Location 20:17348941-17348963
Sequence TTAGCCAAGGGCAGAGCCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170536823_1170536829 4 Left 1170536823 20:17348941-17348963 CCCGTGGCTCTGCCCTTGGCTAA No data
Right 1170536829 20:17348968-17348990 AGGACCGTTAACCAGCCACTTGG 0: 1
1: 0
2: 0
3: 4
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170536823 Original CRISPR TTAGCCAAGGGCAGAGCCAC GGG (reversed) Intronic
No off target data available for this crispr