ID: 1170536829

View in Genome Browser
Species Human (GRCh38)
Location 20:17348968-17348990
Sequence AGGACCGTTAACCAGCCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170536818_1170536829 24 Left 1170536818 20:17348921-17348943 CCAGCCCACAACAGGCATGACCC No data
Right 1170536829 20:17348968-17348990 AGGACCGTTAACCAGCCACTTGG No data
1170536826_1170536829 -8 Left 1170536826 20:17348953-17348975 CCCTTGGCTAACCATAGGACCGT No data
Right 1170536829 20:17348968-17348990 AGGACCGTTAACCAGCCACTTGG No data
1170536824_1170536829 3 Left 1170536824 20:17348942-17348964 CCGTGGCTCTGCCCTTGGCTAAC No data
Right 1170536829 20:17348968-17348990 AGGACCGTTAACCAGCCACTTGG No data
1170536819_1170536829 20 Left 1170536819 20:17348925-17348947 CCCACAACAGGCATGACCCGTGG No data
Right 1170536829 20:17348968-17348990 AGGACCGTTAACCAGCCACTTGG No data
1170536827_1170536829 -9 Left 1170536827 20:17348954-17348976 CCTTGGCTAACCATAGGACCGTT No data
Right 1170536829 20:17348968-17348990 AGGACCGTTAACCAGCCACTTGG No data
1170536821_1170536829 19 Left 1170536821 20:17348926-17348948 CCACAACAGGCATGACCCGTGGC No data
Right 1170536829 20:17348968-17348990 AGGACCGTTAACCAGCCACTTGG No data
1170536823_1170536829 4 Left 1170536823 20:17348941-17348963 CCCGTGGCTCTGCCCTTGGCTAA No data
Right 1170536829 20:17348968-17348990 AGGACCGTTAACCAGCCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170536829 Original CRISPR AGGACCGTTAACCAGCCACT TGG Intronic