ID: 1170538469

View in Genome Browser
Species Human (GRCh38)
Location 20:17364892-17364914
Sequence GGTTGCCACTGGAGCTCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170538461_1170538469 30 Left 1170538461 20:17364839-17364861 CCGCTGGGCTGCACATCCATGAT 0: 1
1: 0
2: 2
3: 13
4: 132
Right 1170538469 20:17364892-17364914 GGTTGCCACTGGAGCTCAGCTGG 0: 1
1: 0
2: 1
3: 12
4: 136
1170538463_1170538469 14 Left 1170538463 20:17364855-17364877 CCATGATGGTGCACTCCTATCGC 0: 1
1: 0
2: 0
3: 5
4: 92
Right 1170538469 20:17364892-17364914 GGTTGCCACTGGAGCTCAGCTGG 0: 1
1: 0
2: 1
3: 12
4: 136
1170538466_1170538469 -1 Left 1170538466 20:17364870-17364892 CCTATCGCTGGTGGTTGTTGCTG 0: 1
1: 0
2: 0
3: 13
4: 107
Right 1170538469 20:17364892-17364914 GGTTGCCACTGGAGCTCAGCTGG 0: 1
1: 0
2: 1
3: 12
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170538469 Original CRISPR GGTTGCCACTGGAGCTCAGC TGG Intronic
900245249 1:1633459-1633481 GGCTGCCACTGGAGTCTAGCAGG + Intronic
900252375 1:1677885-1677907 GATTCCCACTGGACCTCAGGAGG - Intronic
900256480 1:1700618-1700640 GGCTGCCACTGGAGTCTAGCAGG + Intronic
902758434 1:18565032-18565054 GGTTGCCTCTGGGGCTAAGCTGG - Intergenic
903086514 1:20864637-20864659 TGTTGCCAATGGATCTCCGCCGG + Exonic
903705524 1:25282771-25282793 GGTTCCCACTGAAGCACAGGAGG + Intronic
903721706 1:25410549-25410571 GGTTCCCACTGAAGCACAGGAGG - Intronic
904835161 1:33331083-33331105 GGGTGCCAGTGGAGCCCAGGAGG + Intronic
905534056 1:38705208-38705230 GTGTGAGACTGGAGCTCAGCGGG + Intergenic
905662672 1:39739335-39739357 GGGGCCCGCTGGAGCTCAGCGGG - Intronic
905970961 1:42142101-42142123 CGTGGCCACTTGAGCTCAGGGGG + Intergenic
906416432 1:45623741-45623763 AGTTGCCACTGAACCCCAGCGGG - Exonic
907462154 1:54611526-54611548 GGTGGGCACTGGAGCAGAGCTGG - Intronic
907511871 1:54967465-54967487 GGTTCCCACTTGATCACAGCTGG + Intergenic
908740131 1:67318771-67318793 GGATGAGACTGGAGCTCAGGGGG + Intronic
910529220 1:88216581-88216603 TGTTCACACTGGAGCTCAGCAGG - Intergenic
911955269 1:104225620-104225642 GGTGGCTACTGGAGCCTAGCAGG + Intergenic
913142970 1:115960094-115960116 GGTTGCCACTTGAGCTGAACAGG - Intergenic
915086822 1:153394765-153394787 GATTGTCCCTGGAGCTGAGCTGG - Intergenic
918190698 1:182171373-182171395 GGCGGCCACTGGATATCAGCTGG + Intergenic
924784164 1:247179895-247179917 GGTAGCCACTTGAGCCCAGGGGG + Intergenic
1064601821 10:17001298-17001320 GATTGCCACTGGTGCGCAGGAGG + Intronic
1066195568 10:33096272-33096294 GGCTGCCTGTGGAGCACAGCTGG - Intergenic
1069801613 10:71085274-71085296 TGAGGCCACAGGAGCTCAGCAGG - Intergenic
1076200478 10:128553874-128553896 GCTTGGAACTGGAGCTGAGCTGG + Intergenic
1077373568 11:2194921-2194943 GGTGGCCAGCGGAGCTTAGCTGG - Intergenic
1077594368 11:3519025-3519047 GGCTGCCGCTGTAGCCCAGCTGG - Intergenic
1081835399 11:46149458-46149480 GGGTGCCACTAGCGGTCAGCTGG - Intergenic
1086037314 11:82432234-82432256 GGTTGCTTCTGGAGCTCTGAAGG - Intergenic
1088228686 11:107650350-107650372 GGATGCCACAGCAGCTCAGCAGG + Exonic
1088889897 11:114036218-114036240 GGTGACCACTAGAGGTCAGCAGG + Intergenic
1088995252 11:114990235-114990257 GGTTACCACTTGAGCACAGGGGG - Intergenic
1090157763 11:124459639-124459661 GGTTGCCACTGGGGCTCAGGCGG - Intergenic
1090868473 11:130722708-130722730 GGTTAGCACTGGGGCTGAGCAGG + Intergenic
1093104132 12:15065732-15065754 GGTTGCTGCTGAGGCTCAGCAGG + Intergenic
1101449234 12:104761239-104761261 GGATGCCACAGGAGAGCAGCAGG + Exonic
1102953540 12:117045555-117045577 GTTTGCCTCTGGAGCCCAGGGGG - Intronic
1105586388 13:21748456-21748478 AATAGCCTCTGGAGCTCAGCTGG - Intergenic
1105899745 13:24744465-24744487 GGTTGGCACTGGAGCCCGGTGGG + Intergenic
1106535174 13:30634286-30634308 CGTTGCCAGTGGAACACAGCAGG + Intronic
1106557735 13:30824909-30824931 GGCTGCCACTGGCGCTGCGCGGG - Intergenic
1107783216 13:43927126-43927148 TGTTGCCAAAGGAGATCAGCAGG - Intergenic
1108255848 13:48610780-48610802 GGTGGCCACTGGAACTGTGCTGG + Intergenic
1111061552 13:83025482-83025504 GGGTGGCACTGGAGCACACCAGG - Intergenic
1113562066 13:111289370-111289392 TGTTGCCAGTGAAGCACAGCAGG + Intronic
1118878696 14:69808080-69808102 GCCTGCCACTGGGGCTCAGGTGG + Intergenic
1202855872 14_GL000225v1_random:52040-52062 GTTTGCTCCTGGAGCTCTGCGGG + Intergenic
1131666417 15:94576044-94576066 GGTTGCCAGTGGAGGTCATTAGG - Intergenic
1132951252 16:2563634-2563656 GGATGACACTGGAGGACAGCAGG - Intronic
1132963098 16:2636536-2636558 GGATGACACTGGAGGACAGCAGG + Intergenic
1137315614 16:47318144-47318166 GGTTGCCACTGGAGGGGAGCAGG - Intronic
1138461017 16:57147651-57147673 GCTGGGCACTGGAGCTCAGGCGG - Exonic
1139606724 16:68023916-68023938 GGAAGCCAGTGGAGCTGAGCGGG - Intronic
1140877762 16:79168795-79168817 GGTCTCAACTGGATCTCAGCTGG - Intronic
1142518886 17:491476-491498 GGTCACCCCTGGTGCTCAGCTGG + Intergenic
1142676382 17:1516234-1516256 CGTTCCCACTGGGGCGCAGCAGG - Intronic
1144265304 17:13562763-13562785 GCTGGCTCCTGGAGCTCAGCTGG - Intronic
1144417601 17:15066354-15066376 GGATGCAACTGGATCTCAGAGGG + Intergenic
1145210741 17:21011349-21011371 GGTTGCCTCTGGAGCTGGGTGGG - Intronic
1145810074 17:27759241-27759263 GGATGCCCCTGGGGCTCGGCTGG + Intronic
1148539957 17:48472518-48472540 GGTAGCAACTGGAACTGAGCAGG - Intergenic
1149354615 17:55827258-55827280 TGTTGTCACTGGGGCTGAGCAGG - Intronic
1150384465 17:64747469-64747491 TGTTGGAATTGGAGCTCAGCAGG - Intergenic
1150758446 17:67937659-67937681 GGTAGCCAGTGGATCTCAGGGGG + Intronic
1156284124 18:35674384-35674406 GGGTGCTATTGAAGCTCAGCGGG + Intronic
1157210983 18:45741803-45741825 GGTTTCCACCTGAGTTCAGCTGG + Intronic
1157396422 18:47345528-47345550 GGTGGCCACTGGAGGTCAGTGGG + Intergenic
1160242093 18:77131954-77131976 GGCCGCCCCTGGAGCTCAGAGGG + Intronic
1160392250 18:78543048-78543070 GGGAGCCCATGGAGCTCAGCAGG - Intergenic
1164527604 19:29023290-29023312 GGATGCCTCTGGACCTCTGCAGG - Intergenic
1167220739 19:48196618-48196640 GGTTTCCACTGGACCGGAGCTGG + Intronic
926213294 2:10887432-10887454 GGTGGCAATTGCAGCTCAGCAGG - Intergenic
933006974 2:77006801-77006823 GATTTCCACTGAAGCTTAGCTGG - Intronic
933207871 2:79529976-79529998 AGGAGCCACTGGAGCTCTGCTGG + Intronic
934717472 2:96552049-96552071 GGGTGCCAGTGAAGTTCAGCGGG - Exonic
935529755 2:104218026-104218048 TGTGGCCACTGGGTCTCAGCTGG - Intergenic
937334965 2:121056582-121056604 GGCTGCCTCTGGATCTCACCTGG - Intergenic
937881798 2:126872939-126872961 GGTTATCACAGGAGCACAGCTGG + Intergenic
938921153 2:135996290-135996312 CATTCCAACTGGAGCTCAGCTGG - Intergenic
946164774 2:217857306-217857328 GGCTGACAATGAAGCTCAGCAGG + Intronic
948239699 2:236419667-236419689 TGTTGCCATTGGAGCCTAGCAGG - Intronic
1170538469 20:17364892-17364914 GGTTGCCACTGGAGCTCAGCTGG + Intronic
1170816000 20:19714948-19714970 GTTTGACCCTGGAGCTCAGAGGG + Intronic
1173823123 20:46031164-46031186 GGTTTCCACAGGGGCTCAGGAGG + Intronic
1175707901 20:61194724-61194746 GGTACCCACTGGAGCTTAGACGG - Intergenic
1175994623 20:62806611-62806633 GGTCCCAGCTGGAGCTCAGCGGG + Intronic
1176410326 21:6446228-6446250 GAGTGCCTCAGGAGCTCAGCCGG - Intergenic
1178303769 21:31473575-31473597 GGTGGCCCCTGGAGCACAGCTGG + Intronic
1179308318 21:40174930-40174952 GGTGGTCACTGGAGCTCTGATGG + Intronic
1179685819 21:43054550-43054572 GAGTGCCTCAGGAGCTCAGCCGG - Intronic
1182435450 22:30326896-30326918 GGTGGCCGCTGGAGCTCAGGCGG - Exonic
1183092133 22:35529743-35529765 GTTTGCAAATGAAGCTCAGCTGG + Intergenic
1184032525 22:41903367-41903389 GCCTGGCCCTGGAGCTCAGCAGG + Intronic
1185154748 22:49186630-49186652 GGTTGTCAGTGGAGCTCAGGTGG + Intergenic
953126769 3:40097908-40097930 TGTTGCCACAGGAATTCAGCTGG + Intronic
954480505 3:50795998-50796020 GGTTCCCAATGGCGCTCAGATGG - Intronic
954914356 3:54136046-54136068 GATTTCCAGTGGAGATCAGCTGG - Intronic
958769908 3:98413944-98413966 GGCTCCAAGTGGAGCTCAGCTGG - Intergenic
962409347 3:135127825-135127847 GGTTGTCACTGGAGTTAAACAGG - Intronic
964344014 3:155738034-155738056 AATTGCCACTGGATGTCAGCGGG - Intronic
964704709 3:159605811-159605833 GGTAGCTACAGGATCTCAGCGGG + Intronic
968072963 3:195798973-195798995 GGAGGCCACCAGAGCTCAGCAGG - Intronic
968917243 4:3501906-3501928 AGCTGCCACTGCTGCTCAGCGGG + Intergenic
971711090 4:30113516-30113538 GGTGGCCACATGAGCTGAGCAGG + Intergenic
974145615 4:57943782-57943804 GGTAGCCTGTGGAGCGCAGCAGG - Intergenic
974589097 4:63920077-63920099 GTTTTTCACTGTAGCTCAGCTGG + Intergenic
975627314 4:76362931-76362953 GGTTGCTACTTGAGGTAAGCTGG + Intronic
980875667 4:138659561-138659583 GGGTGGCACTGGAGGTGAGCAGG + Intergenic
980992041 4:139746669-139746691 GTTTGACACTGGACCTCCGCAGG + Intronic
982721865 4:158868235-158868257 GATTGCCACTCCAGGTCAGCTGG - Exonic
988559772 5:32270158-32270180 GGATACCACTGGACTTCAGCCGG + Intronic
990130858 5:52581219-52581241 AGTTGGAACTGGAGCTCTGCAGG - Intergenic
991967394 5:72107067-72107089 GGCTGCAGCAGGAGCTCAGCGGG + Intergenic
993340592 5:86720419-86720441 GGTAGGCACTGGAGGGCAGCTGG - Intergenic
997386942 5:133481010-133481032 GGGTTCCACTGGAACCCAGCGGG - Intronic
999654679 5:153800191-153800213 GGTTGACAGTGGAGCTCAGAAGG - Intronic
999983082 5:156976506-156976528 AGTTCCCACTGGAGCTCAAGTGG - Intergenic
1000700366 5:164442259-164442281 GTTTGCCAGTGCAGCCCAGCTGG + Intergenic
1003611024 6:7615089-7615111 GTTTGCCACTGGAACTAGGCAGG - Intergenic
1007656572 6:43454718-43454740 GGCCGCGACTGGAGCCCAGCGGG + Intronic
1007795217 6:44341680-44341702 GGTTGTCAGTTGAGGTCAGCAGG - Intronic
1007935420 6:45728145-45728167 TGCAGGCACTGGAGCTCAGCTGG - Intergenic
1013667905 6:112366878-112366900 TGTTGCCACTGGCGCTGCGCCGG + Intergenic
1015508144 6:134010441-134010463 CGCAGCCACTGGAGTTCAGCAGG + Intronic
1016430007 6:143973504-143973526 GGGGGCCATTGAAGCTCAGCAGG - Intronic
1020678301 7:11205778-11205800 GGTTGTAAGTGGAGCTCAGTGGG + Intergenic
1022818401 7:33935292-33935314 TGTGGCCACTGGGGCTGAGCTGG - Intronic
1030590627 7:111477205-111477227 GGTGGGCACTGGACCTAAGCAGG - Intronic
1032949448 7:136890611-136890633 AGTACTCACTGGAGCTCAGCGGG - Intronic
1034088920 7:148346059-148346081 GGGTGACACTGGCGCTCAGGGGG - Intronic
1034338170 7:150336791-150336813 GGGTTCCACTGGGGGTCAGCTGG - Exonic
1038053239 8:23833166-23833188 GGCTTCCTTTGGAGCTCAGCAGG + Intergenic
1039073434 8:33666966-33666988 GGTTGCCTAGGGAGCTCAGAGGG - Intergenic
1040068708 8:43171256-43171278 GGTTGTCACTAGAGTTCAGAAGG - Intronic
1040389059 8:46933926-46933948 GGTCGCTCCTGGAGCTCAGCAGG + Intergenic
1040601015 8:48883849-48883871 GTTTTCCACTGGAGCTTGGCTGG + Intergenic
1042094121 8:65193127-65193149 AGTTGACACTTGAGCCCAGCAGG + Intergenic
1049242777 8:141546883-141546905 GGTGGCACCTGAAGCTCAGCTGG + Intergenic
1049424610 8:142532513-142532535 GGTGGCCGCTGGGGCTCAGGAGG + Intronic
1049611823 8:143559416-143559438 GGAAGCCAGTGGAGCTCTGCAGG - Exonic
1055885421 9:81057286-81057308 GGCTTCAGCTGGAGCTCAGCTGG - Intergenic
1057083381 9:92188934-92188956 GGTGGCCACAGCAGCTCATCCGG + Intergenic
1057481442 9:95448204-95448226 GATTCACACTGCAGCTCAGCGGG + Intronic
1057869836 9:98709119-98709141 GGCAGCCCCTGGAGCTCGGCCGG + Exonic
1059446949 9:114344085-114344107 GGTTGCTACTGGATGTCAGCTGG - Intronic
1059697710 9:116744589-116744611 AGTTGGCAATGGAGATCAGCAGG - Intronic
1061498750 9:130990438-130990460 GGTGGTCACTGGAGCTATGCAGG - Intergenic
1187708598 X:22031363-22031385 AGGTGACACAGGAGCTCAGCAGG - Intergenic
1189287471 X:39861672-39861694 GGGTGCTACTGGAGTTTAGCAGG - Intergenic
1191671269 X:63750988-63751010 GGTGGGCTCTGGAGCTCAGTGGG + Intronic