ID: 1170539651

View in Genome Browser
Species Human (GRCh38)
Location 20:17374978-17375000
Sequence CTAAGGCTGCATCATGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170539651_1170539656 27 Left 1170539651 20:17374978-17375000 CCTACCTCATGATGCAGCCTTAG No data
Right 1170539656 20:17375028-17375050 TAATTTTTTCATCCGTGAAATGG No data
1170539651_1170539657 28 Left 1170539651 20:17374978-17375000 CCTACCTCATGATGCAGCCTTAG No data
Right 1170539657 20:17375029-17375051 AATTTTTTCATCCGTGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170539651 Original CRISPR CTAAGGCTGCATCATGAGGT AGG (reversed) Intronic