ID: 1170539843

View in Genome Browser
Species Human (GRCh38)
Location 20:17376428-17376450
Sequence CCTCAAGTACTGTAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 111}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170539843_1170539849 4 Left 1170539843 20:17376428-17376450 CCATCCTCCTACAGTACTTGAGG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 1170539849 20:17376455-17376477 CCCCAGTCTGGAGAGAATATTGG 0: 1
1: 0
2: 0
3: 9
4: 132
1170539843_1170539847 -8 Left 1170539843 20:17376428-17376450 CCATCCTCCTACAGTACTTGAGG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 1170539847 20:17376443-17376465 ACTTGAGGTGTACCCCAGTCTGG 0: 1
1: 0
2: 0
3: 6
4: 69
1170539843_1170539852 12 Left 1170539843 20:17376428-17376450 CCATCCTCCTACAGTACTTGAGG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 1170539852 20:17376463-17376485 TGGAGAGAATATTGGCTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170539843 Original CRISPR CCTCAAGTACTGTAGGAGGA TGG (reversed) Intronic
900106220 1:982238-982260 CCTCATGTACTGTAGCTGGAGGG - Intergenic
900658563 1:3772162-3772184 CCTCAAGCCCCGGAGGAGGACGG + Intergenic
901134513 1:6984243-6984265 CATCAAGTACTTTGGGAGGCCGG + Intronic
901853920 1:12032064-12032086 CCTCAAGTGCATTAGCAGGATGG - Intergenic
902087236 1:13873021-13873043 GCTCAAGGACTCTAGGGGGATGG - Intergenic
903023772 1:20412474-20412496 CCTTAAAGACTGTAGGAGGAGGG + Intergenic
903630211 1:24763066-24763088 CCTCAAGTAAAGAAGTAGGAGGG - Intronic
904537161 1:31207481-31207503 ACTCATGTACTGAAGGAGAAAGG + Intronic
917731320 1:177877587-177877609 GGTCAAGTACTGGGGGAGGAAGG + Intergenic
923834670 1:237597146-237597168 CCTCTAGTACTCTAGTATGAAGG + Intronic
1066727569 10:38409237-38409259 CCTGAAGTATTGTAGGGGGTAGG + Intergenic
1071285803 10:84143741-84143763 CCTCAAATATTGTTGGAGGGAGG + Intronic
1075466821 10:122657694-122657716 CCCTTAGTACTGGAGGAGGAAGG + Intergenic
1075671090 10:124264623-124264645 CCTCCAGTGCTGTAGCAGGCTGG + Intergenic
1076445686 10:130512315-130512337 CGTGAAGTACTGTGGGAAGAGGG + Intergenic
1077249435 11:1554478-1554500 CCTCCAGTGCTGCAGGAGGCGGG - Exonic
1078276800 11:9856412-9856434 CCCCAAGAAGAGTAGGAGGAGGG + Intronic
1081194490 11:40144645-40144667 CCTCAACAAATATAGGAGGAAGG + Intronic
1084181815 11:67450722-67450744 CCTCAATGACTGTTGGGGGAAGG + Intergenic
1085466740 11:76729142-76729164 CCTCATGTCCTGTAGGTGCAGGG - Intergenic
1086782863 11:90929412-90929434 CCTTAAGTCCTGTAGAGGGAAGG - Intergenic
1090439403 11:126713468-126713490 CCTCAAGGTATGTAGGAAGATGG + Intronic
1091350852 11:134892821-134892843 CCACAAGAACTGTATGGGGAAGG - Intergenic
1092225784 12:6747551-6747573 TCTCAACTACTGTGGGTGGAGGG + Intergenic
1093004424 12:14036074-14036096 GCTCAAGCTTTGTAGGAGGAGGG + Intergenic
1093369884 12:18354228-18354250 CCTCAAGTCCTGTAGGTAGAAGG + Intronic
1096814572 12:54193803-54193825 CCCCAAGTCCTTTAGCAGGAAGG + Intergenic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1101697522 12:107140389-107140411 CCTCCAGAACTGTAAGAGAATGG + Intergenic
1102793641 12:115669870-115669892 CCAAAAGTGCTGAAGGAGGAAGG - Intergenic
1109303951 13:60618494-60618516 CCTCAAGTTTTATAGGGGGAGGG + Intergenic
1112443133 13:99439568-99439590 CCTGTAGCACTGTAGAAGGACGG - Intergenic
1121073680 14:91048777-91048799 CCTAAAGTGCTGTGGGAGGGAGG - Intronic
1122138504 14:99648185-99648207 CCTCAAGGAGTGTAGGAACAAGG + Intronic
1122718898 14:103711427-103711449 ACTCAACTGCTGCAGGAGGATGG - Intronic
1126942134 15:53778846-53778868 CCTCCAGTCCTGTAGTTGGAGGG + Intergenic
1133773645 16:8882259-8882281 CCTCACTTCCTGCAGGAGGAGGG - Intergenic
1134403590 16:13935433-13935455 CCTGAAGAACTGGAAGAGGAAGG + Exonic
1144414481 17:15033443-15033465 TATCAAGTTCTGTAGAAGGAAGG + Intergenic
1146113865 17:30116632-30116654 CCTCAAAATCTGTAGGAGAAAGG - Intronic
1146561168 17:33871705-33871727 CCTGAATTACGGGAGGAGGAGGG + Intronic
1151460996 17:74253821-74253843 CCCCAATTACCGTAGGCGGAGGG - Exonic
1152244764 17:79179541-79179563 CTTCAAGTATTGTAAGGGGAGGG - Intronic
1156526101 18:37768738-37768760 CACCAAAGACTGTAGGAGGAAGG + Intergenic
1156592637 18:38508999-38509021 CATCAAGTCCTGTAGGATTAGGG + Intergenic
1157341974 18:46787022-46787044 CCTCAATTCTTGGAGGAGGAAGG + Intergenic
1157782884 18:50455943-50455965 CCTCAAGTATTGGAGGGAGATGG + Intergenic
1158003637 18:52647332-52647354 CTTCAAGTTGGGTAGGAGGAAGG - Intronic
1158311410 18:56163404-56163426 CCTAAAGCACTGTATTAGGATGG + Intergenic
1158482660 18:57835693-57835715 CCCCAAGTTCAGCAGGAGGATGG - Intergenic
1160030044 18:75250036-75250058 CCCCACCTACTGCAGGAGGAAGG - Intronic
1163839158 19:19595343-19595365 CCCCAAGTACTGCAGGCTGAGGG - Intronic
1164769073 19:30794474-30794496 CCTCAAGTAAGGTTAGAGGAGGG + Intergenic
1165021808 19:32930653-32930675 CCCCAAGTTCTGTAAGAGTAAGG + Intronic
925025247 2:602101-602123 CCTCAAGCCCTGGAGGAAGAAGG - Intergenic
929946602 2:46376967-46376989 CACCAAGTGCTGTACGAGGAGGG + Intronic
935603962 2:104951104-104951126 CCTAAAGTAATGGAGGAGTAAGG - Intergenic
941720069 2:168803114-168803136 TCACAAGTCCTGCAGGAGGAAGG + Intronic
942584628 2:177461939-177461961 AGTTCAGTACTGTAGGAGGATGG + Exonic
944480668 2:200154331-200154353 ACTCCAGGACAGTAGGAGGAGGG + Intergenic
948552088 2:238779392-238779414 CCTCATGTGCTGGAGGATGATGG + Intergenic
949004992 2:241640729-241640751 CTTAAAGCAGTGTAGGAGGAAGG + Intronic
1170523985 20:17218280-17218302 CCTCCAGTACTCTAGGGGGAGGG + Intergenic
1170539843 20:17376428-17376450 CCTCAAGTACTGTAGGAGGATGG - Intronic
1175052044 20:56164855-56164877 CCTCAAGTACTGAAGTAGGTGGG - Intergenic
1178031063 21:28526700-28526722 CCTGAATTACTGCATGAGGAGGG + Intergenic
1179028399 21:37699379-37699401 CCTCTATTACTGCAGGGGGAAGG + Intronic
1179585282 21:42370502-42370524 CCTCAGGTATTGGAGGAGGCAGG + Intergenic
1182805377 22:33065452-33065474 CCTTACGTGCTGAAGGAGGAGGG + Intergenic
1183951535 22:41355570-41355592 CCTCAAGTACTGTAGTGCCAAGG + Exonic
1184884629 22:47335196-47335218 CCTAAAATACTGGAGGAGGGGGG - Intergenic
956294504 3:67697095-67697117 CCTTAAGTACCTTAGGAGAAAGG - Intergenic
959902959 3:111680385-111680407 CCTCAAATCCTGTAGGAAAATGG - Intronic
960882364 3:122357956-122357978 CCTCAACTAATGAAGGAAGATGG - Intergenic
962247185 3:133805661-133805683 CCTATCGTTCTGTAGGAGGACGG + Exonic
962411236 3:135143353-135143375 CCTCCAGGCCTGGAGGAGGATGG + Intronic
962890766 3:139670829-139670851 TCCCCAGTACTGTGGGAGGAAGG - Intronic
966346941 3:178990517-178990539 CCTCCAGGCCTGTAGCAGGAGGG + Intergenic
966357996 3:179102684-179102706 CCACAAGTAATGTAAGAAGATGG + Intergenic
966627511 3:182034262-182034284 ACTAAAGTATTGTAGGAAGAGGG - Intergenic
969226710 4:5803334-5803356 CCTCAAGTTCTTCAGGAGAAGGG - Intronic
972354637 4:38269000-38269022 CCTCTAGTACTGCAAGAGAAAGG - Intergenic
978372880 4:108046801-108046823 CTTCAAGTACAGTATGAGGAGGG + Intergenic
985606262 5:859805-859827 CCTTGAGTACTGAGGGAGGAGGG - Intronic
987991160 5:25214572-25214594 CTCCAAATAATGTAGGAGGAGGG + Intergenic
988482218 5:31639803-31639825 CCTCCACTCCTGTCGGAGGAAGG - Intronic
988923039 5:35962303-35962325 CTTTAAGTCCTGTAGGGGGAAGG + Intronic
991198812 5:63965696-63965718 CCCCAAATACTGTAGCAGTAGGG + Intergenic
992270607 5:75059158-75059180 CCACAAAAACTGTAGGAGGGAGG + Intergenic
1001093902 5:168761541-168761563 CCCCAACCACTGTAGGAGGTAGG + Intronic
1002908426 6:1469660-1469682 CCTCAGGTACTGTAAGAGCTGGG + Intergenic
1003801878 6:9679074-9679096 CATCTAGTTCTGAAGGAGGAAGG - Intronic
1006032217 6:31185465-31185487 TCTTAACTACTGTAGGGGGAAGG + Intergenic
1006389929 6:33752257-33752279 CATCAAGGACTGCAGGAGGAAGG + Intergenic
1007010396 6:38411567-38411589 CCTCATGTACAGTATGAAGATGG - Intronic
1007198876 6:40088447-40088469 CCTCAAGCTCTGAAGGGGGAGGG - Intergenic
1008857887 6:56113288-56113310 CCTCAAGGATTATAGAAGGAAGG - Intronic
1013168309 6:107614100-107614122 CCTTAAGTACAGTAGGAGTAAGG + Intronic
1013195768 6:107844297-107844319 CCTCAAGTACAGAAGTAGAATGG + Intergenic
1016735629 6:147476723-147476745 CCTCAGAGACAGTAGGAGGAAGG - Intergenic
1017437715 6:154432973-154432995 CCTCAACATCAGTAGGAGGAAGG + Intronic
1019230487 6:170557078-170557100 CCTCAGGTAATATAGCAGGAGGG + Exonic
1026576303 7:71574431-71574453 CTTGAAGTACTGTAAGAGGCAGG - Intronic
1028799963 7:94951675-94951697 CCAGAAGGACAGTAGGAGGAAGG - Intronic
1036497230 8:9280339-9280361 CCCCCAGAACTGTAGAAGGATGG - Intergenic
1036568665 8:9960362-9960384 CCTCAAGTGCTGGATGGGGAAGG + Intergenic
1038193426 8:25344548-25344570 CCTCCAGTTCTGTGGAAGGAAGG + Intronic
1051192968 9:14534240-14534262 CCTCAGGTGCTCTAGGTGGAAGG + Intergenic
1057895426 9:98904988-98905010 ACTCAAGTAATGGAGGAGGCTGG - Intergenic
1058918217 9:109587871-109587893 CCTCAGAGACTGCAGGAGGAAGG + Intergenic
1058925166 9:109656156-109656178 CCTCATGTAACATAGGAGGAAGG + Intronic
1060846870 9:126844429-126844451 TTTCAAGTACTGTGGAAGGATGG + Intergenic
1061336205 9:129938579-129938601 GCTCCAGTATTGTAGGTGGAGGG + Intronic
1062261489 9:135665299-135665321 CCTGAAGTTCTGGAGGTGGAAGG - Exonic
1185705212 X:2261861-2261883 CCACCAGTGCTGTACGAGGAAGG + Intronic
1189220747 X:39369548-39369570 TGTTAAGTACTGTAGGAGCATGG + Intergenic
1196191200 X:112796683-112796705 CTTGGAGTACTGTAGGAGGCGGG - Intronic
1197610446 X:128632474-128632496 CCTCAAGTGCTTTAGATGGAAGG - Intergenic
1199055712 X:143291697-143291719 CCTCAAGAATGGTAGGGGGAGGG - Intergenic
1201921056 Y:19233481-19233503 CTTCAAGTACTATAGGGAGAAGG - Intergenic