ID: 1170540522

View in Genome Browser
Species Human (GRCh38)
Location 20:17382851-17382873
Sequence GAATCCTGGATTGTAGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 229}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170540522_1170540525 -4 Left 1170540522 20:17382851-17382873 CCAGACTCTACAATCCAGGATTC 0: 1
1: 0
2: 0
3: 7
4: 229
Right 1170540525 20:17382870-17382892 ATTCTCCCTAATTAAAGGCTTGG 0: 1
1: 0
2: 0
3: 12
4: 117
1170540522_1170540524 -9 Left 1170540522 20:17382851-17382873 CCAGACTCTACAATCCAGGATTC 0: 1
1: 0
2: 0
3: 7
4: 229
Right 1170540524 20:17382865-17382887 CCAGGATTCTCCCTAATTAAAGG 0: 1
1: 0
2: 3
3: 2
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170540522 Original CRISPR GAATCCTGGATTGTAGAGTC TGG (reversed) Intronic
905329535 1:37183342-37183364 GATTGCTGGATTGTATAGTAAGG - Intergenic
908111095 1:60898237-60898259 GAATCCTGGAATTTTGAATCAGG - Intronic
908461543 1:64352461-64352483 GAATAATGGGTTGTAGAGGCAGG + Intergenic
908852578 1:68389480-68389502 GAATAATGGGTTGTAGAGGCAGG - Intergenic
909035636 1:70591512-70591534 GAATAATGGGTTGTAGAGGCAGG - Intergenic
909223490 1:72990309-72990331 GAATAATGGGTTGTAGAGGCAGG + Intergenic
910049559 1:82958557-82958579 GAATAATGGATTGTAGAGGGAGG - Intergenic
911570555 1:99512836-99512858 GAATAATGGGTTGTAGAGGCAGG - Intergenic
912565854 1:110586818-110586840 GAATCCTGGCTAGTCCAGTCTGG - Intergenic
915161483 1:153923336-153923358 GAATCCCGGTTTGGAGAGACTGG - Intergenic
918347286 1:183616864-183616886 GAATAATGGGTTGTAGAGGCAGG - Intergenic
918567500 1:185950793-185950815 GAATAATGGGTTGTAGAGGCAGG + Intronic
921212585 1:212912717-212912739 GAATAATGGGTTGTAGAGGCAGG - Intergenic
922906562 1:229177646-229177668 GAATAATGGATTATAGAGGCAGG - Intergenic
923244920 1:232121395-232121417 GAATAATGGGTTGTAGAGGCAGG - Intergenic
923356823 1:233164852-233164874 GAATAGTGGTTTGTAGAGGCTGG + Intronic
1062841499 10:676760-676782 GAATAGTGGATTCTAGAGACAGG + Intronic
1063509426 10:6632093-6632115 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1063527512 10:6799593-6799615 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1065368451 10:24957171-24957193 GAATACTGGTTAGCAGAGTCAGG - Intergenic
1065442955 10:25771248-25771270 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1065480169 10:26185307-26185329 GAATCCTGGAATGTATGGTATGG - Intronic
1068179489 10:53501530-53501552 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1069897431 10:71688384-71688406 GAGTCATGGATAGTGGAGTCAGG + Intronic
1070250099 10:74766046-74766068 GAATCCTGGAAGCTGGAGTCTGG - Intergenic
1070475092 10:76821790-76821812 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1071080910 10:81809666-81809688 GAACCCTGGATTGTTGATTTTGG - Intergenic
1071474793 10:86016845-86016867 GGACCCTGGACTTTAGAGTCAGG + Intronic
1072011160 10:91304239-91304261 GAATAATGGATTGTAGAGGCAGG + Intergenic
1075337781 10:121621058-121621080 GAGTCTTGGAGTGTGGAGTCAGG + Intergenic
1075642438 10:124074459-124074481 GAATCCTTGTTTCTAGAGACTGG - Intronic
1077344959 11:2042823-2042845 GAATTCTGGACTGTAGATTATGG - Intergenic
1077835908 11:5928395-5928417 GAATCCAGGAATGCTGAGTCAGG - Intronic
1077837573 11:5937977-5937999 GAATCCGGGAATGCTGAGTCAGG - Intronic
1078045966 11:7914660-7914682 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1079305839 11:19321056-19321078 AAAAGCTGAATTGTAGAGTCTGG + Intergenic
1080027746 11:27631579-27631601 GAATAATGGGTTGTAGAGACAGG + Intergenic
1082679635 11:56152419-56152441 GAATCCGGGAGTGCTGAGTCAGG - Intergenic
1086462273 11:87017743-87017765 GAATCCTGGAATTTGGAGTTTGG + Intergenic
1091183846 11:133630005-133630027 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1202827889 11_KI270721v1_random:97696-97718 GAATTCTGGACTGTAGATTATGG - Intergenic
1091886689 12:4021759-4021781 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1097416887 12:59325716-59325738 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1097542023 12:60954484-60954506 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1098173470 12:67769144-67769166 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1098629227 12:72706566-72706588 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1099762754 12:86942015-86942037 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1100561526 12:95752376-95752398 GAATAATGGGTTGTAGAGGCAGG - Intronic
1103005360 12:117416420-117416442 GGCTCCTGGATAGTAGAGCCTGG + Intronic
1103245198 12:119450917-119450939 GCAGCCTGGACTGCAGAGTCTGG + Intronic
1105246360 13:18654904-18654926 GATTCCTGGAATGCACAGTCTGG + Intergenic
1106457062 13:29936680-29936702 GCCTCCTGGATAGAAGAGTCAGG + Intergenic
1106807044 13:33320323-33320345 GAATCCTGGAGTGTGGTCTCTGG - Intronic
1107075752 13:36319657-36319679 GAATAATGGGTTGTAGAGGCAGG - Intronic
1107220128 13:37971672-37971694 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1107682971 13:42869914-42869936 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1108513163 13:51173080-51173102 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1108814294 13:54270073-54270095 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1109709496 13:66143829-66143851 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1110052313 13:70919754-70919776 GAATGCTGGATACTAGAGGCTGG - Intergenic
1111302212 13:86361625-86361647 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1111458675 13:88515328-88515350 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1115904976 14:38194008-38194030 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1116179844 14:41519160-41519182 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1116185626 14:41597744-41597766 GAATCCGGGAATGCTGAGTCAGG - Intergenic
1116613680 14:47107398-47107420 GAATAATGGGTTGTAGAGGCAGG - Intronic
1116828089 14:49691439-49691461 TCCTCCTGGACTGTAGAGTCTGG - Intergenic
1121423323 14:93831168-93831190 AAATCCTGTAGTGTAGAGTAGGG + Intergenic
1122036293 14:98951433-98951455 CAAGCCAGCATTGTAGAGTCAGG + Intergenic
1122041163 14:98988412-98988434 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1126990337 15:54367724-54367746 AAATCTTGGATTGTAGACTGAGG + Intronic
1127659073 15:61083133-61083155 GAATCCTGCAGTGAACAGTCAGG - Intronic
1129790749 15:78339390-78339412 GAATCCTGAATTGTACAGTTTGG + Intergenic
1130855272 15:87834482-87834504 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1130945781 15:88549997-88550019 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1133525713 16:6603545-6603567 GAATCATGGAGTGTGGAGTGGGG - Intronic
1133662794 16:7935221-7935243 GAATCCTAGAGTATAGAGTAGGG + Intergenic
1133869382 16:9673587-9673609 GAATAATGGGTTGTAGAGGCAGG + Intronic
1133937027 16:10277720-10277742 GAATCCGGGAATGCTGAGTCAGG - Intergenic
1134342011 16:13355063-13355085 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1141796706 16:86279751-86279773 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1141865035 16:86744529-86744551 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1144116258 17:12094924-12094946 GACTCATGGGTTGGAGAGTCAGG + Intronic
1144181130 17:12753475-12753497 GATTCAAGGATTGTAGTGTCTGG - Intronic
1148750204 17:49941172-49941194 GAAGGCTGGATTGGGGAGTCAGG - Intergenic
1153044777 18:845699-845721 GAATCCTGGTGTGCAGAGGCTGG + Intergenic
1154442502 18:14404219-14404241 GATTCCTGGAATGCACAGTCTGG - Intergenic
1155485811 18:26341130-26341152 GTATCTTGGATTCTAGATTCAGG + Intronic
1156430372 18:37066992-37067014 GAATCCTGGACTGCAGACTTAGG - Exonic
1157522037 18:48352064-48352086 GAGTCCTGGCCTGTAGGGTCAGG - Intronic
1160228639 18:77029884-77029906 GAAACCTGGATTTTTGAGCCAGG - Intronic
1163004439 19:14388750-14388772 GAACCCTGGATTGCAGCGACAGG - Exonic
1163063023 19:14773984-14774006 GAACCCTGGATTGCAGCGACAGG + Exonic
1163681977 19:18687983-18688005 GAATCCTGAGTTGTAAAGTTGGG + Intronic
1163907348 19:20158751-20158773 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1164459073 19:28432434-28432456 GAATAATGGATTGTAGAGGGAGG + Intergenic
1164667970 19:30053904-30053926 GAAGCCTGGATTCTAGAGTAGGG - Intergenic
1167705827 19:51080452-51080474 GGATCCAAGATTCTAGAGTCTGG + Intronic
1168051802 19:53834816-53834838 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1168211961 19:54897394-54897416 GAATAATGGGTTGTAGAGGCAGG + Intergenic
926407930 2:12572970-12572992 GAATAATGGGTTGTAGAGGCAGG - Intergenic
926514295 2:13822031-13822053 GAATCCTGGCTTGTATAATCAGG - Intergenic
931625947 2:64255747-64255769 GAATAATGGGTTGTAGAGGCAGG - Intergenic
931759099 2:65400753-65400775 GAATTCTGGATTCCAGATTCAGG - Intronic
932296010 2:70623845-70623867 GAATAATGGGTTGTAGAGGCAGG - Intronic
932854043 2:75216269-75216291 GAATAATGGGTTGTAGAGGCAGG + Intergenic
932973787 2:76576346-76576368 GAATAATGGGTTGTAGAGGCAGG + Intergenic
933013254 2:77091585-77091607 GAATAATGGGTTGTAGAGGCAGG - Intronic
933079433 2:77968318-77968340 GAATAATGGGTTGTAGAGGCAGG - Intergenic
933329350 2:80876963-80876985 GAATAATGGGTTGTAGAGGCAGG + Intergenic
937878050 2:126840492-126840514 GAATCCTGGATTGGAGGTCCTGG - Intergenic
939177677 2:138768527-138768549 GAAGCAAGGATTGTAGAGACAGG + Intronic
939813939 2:146870920-146870942 GTATCCTGGATTATATAGGCAGG + Intergenic
943840286 2:192571962-192571984 GAATCCTGGATTGGATTGACTGG - Intergenic
945376269 2:209081286-209081308 GAATAATGGGTTGTAGAGGCAGG - Intergenic
945986454 2:216358267-216358289 GAACACGGGCTTGTAGAGTCAGG - Intronic
1169406128 20:5322726-5322748 GAAGCCTAGATTTTGGAGTCTGG - Intergenic
1170106400 20:12757090-12757112 GAATAATGGGTTGTAGAGACAGG - Intergenic
1170165908 20:13360162-13360184 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1170540522 20:17382851-17382873 GAATCCTGGATTGTAGAGTCTGG - Intronic
1174033805 20:47652964-47652986 GAATCCTGCAGTGTATAGTATGG + Exonic
1174911411 20:54611890-54611912 CAATCCGGGATTTTAGAGCCGGG + Intronic
1176014110 20:62920049-62920071 GAATCCTGGTATGTAGAATTGGG - Intronic
1177966556 21:27735094-27735116 GAATCTTGAATTGTAGATTGTGG - Intergenic
1182031473 22:27162517-27162539 GAATCCTGAATTGTAGACTTGGG - Intergenic
1182489459 22:30661323-30661345 GCATTCTGGATTTTAGAGTTGGG + Intronic
952564854 3:34642381-34642403 GAATAATGGGTTGTAGAGGCAGG + Intergenic
954712178 3:52510571-52510593 GACTCCTGGAATGCAGAGTCAGG + Intronic
957317142 3:78585640-78585662 GAATAATGGGTTGTAGAGGCAGG + Intergenic
958908422 3:99966889-99966911 GCAGCCTGGATTGTAAAGTCTGG + Intronic
959972096 3:112420057-112420079 GAATAATGGGTTGTAGAGGCAGG + Intergenic
960282707 3:115795996-115796018 GAATAATGGGTTGTAGAGGCAGG + Intergenic
963684494 3:148417562-148417584 GAATAATGGGTTGTAGAGGCAGG - Intergenic
966066996 3:175830919-175830941 GAATAATGGGTTGTAGAGGCAGG - Intergenic
966104933 3:176324125-176324147 GAATAATGGGTTGTAGAGGCAGG + Intergenic
967152288 3:186661232-186661254 GAATAATGGATTGTAGAGGGAGG - Intronic
967211997 3:187178025-187178047 GAATAATGGGTTGTAGAGGCAGG + Intronic
967561548 3:190923323-190923345 GAATAATGGGTTGTAGAGGCAGG - Intergenic
967624484 3:191668980-191669002 GAATAATGGGTTGTAGAGGCAGG + Intergenic
971123019 4:23724520-23724542 GAATAATGGGTTGTAGAGGCTGG + Intergenic
971200301 4:24504225-24504247 GAATAATGGGTTGTAGAGGCAGG - Intergenic
974428236 4:61766796-61766818 GAATAATGGGTTGTAGAGGCAGG + Intronic
975864926 4:78716356-78716378 GAATAATGGGTTGTAGAGGCAGG + Intergenic
975933724 4:79556473-79556495 GAATAATGGGTTGTAGAGGCAGG + Intergenic
976351185 4:84061748-84061770 GAGTCCTGGATAGTAGACTGTGG - Intergenic
977075039 4:92441462-92441484 GAATAATGGATAGTAGAGGCAGG + Intronic
978000957 4:103556259-103556281 GAATAATGGGTTGTAGAGGCAGG + Intergenic
980003192 4:127513947-127513969 GAATAATGGGTTGTAGAGGCAGG + Intergenic
981826589 4:148949324-148949346 GAATCCTGGAATGTTGAGATAGG + Intergenic
982535607 4:156603495-156603517 GAATAATGGGTTGTAGAGGCAGG - Intergenic
982804599 4:159748346-159748368 GAAACCTGGGCTGTAGGGTCTGG + Intergenic
983055648 4:163096286-163096308 GAATAATGGGTTGTAGAGGCAGG - Intergenic
983345717 4:166523738-166523760 GAATAATGGATTGTGGAGGCAGG - Intergenic
983360575 4:166719518-166719540 GAATAATGGGTTGTAGAGGCAGG - Intergenic
983414551 4:167438306-167438328 GAATAATGGGTTGTAGAGGCTGG + Intergenic
984484824 4:180354603-180354625 AAATCCTGGATTTTAGTGTATGG + Intergenic
985535950 5:465878-465900 GAATCCTGGAGTGGAGCGGCAGG + Intronic
986389042 5:7266799-7266821 GAATAATGGGTTGTAGAGGCAGG - Intergenic
986919421 5:12665036-12665058 GAATAATGGGTTGTAGAGGCAGG + Intergenic
987497962 5:18671354-18671376 GAATAATGGGTTGTAGAGGCAGG + Intergenic
991528325 5:67588603-67588625 CAATCCTGGGTTGTACAGTGTGG + Intergenic
992394830 5:76360569-76360591 GAATAATGGGTTGTAGAGGCAGG - Intergenic
993192881 5:84701690-84701712 GAATAATGGGTTGTAGAGGCAGG - Intergenic
994460432 5:100063865-100063887 ACATCCCGGATTGGAGAGTCAGG + Intergenic
994484581 5:100377276-100377298 ACATCCCGGATTGGAGAGTCAGG + Intergenic
994856150 5:105122311-105122333 TTATCCTGGATTTTAGAGTTTGG + Intergenic
994989713 5:106981577-106981599 GAATAATGGGTTGTAGAGGCAGG - Intergenic
996203093 5:120700085-120700107 GAATAATGGGTTGTAGAGGCAGG + Intergenic
996344656 5:122476100-122476122 GAATAATGGGTTGTAGAGGCAGG + Intergenic
996745274 5:126842051-126842073 GAATAATGGGTTGTAGAGGCAGG + Intergenic
998995552 5:147866501-147866523 GAATAATGGGTTGTAGAGGCAGG - Intergenic
998996237 5:147871483-147871505 GAATAATGGGTTGTAGAGGCAGG + Intronic
1000806277 5:165796804-165796826 GAATGTTGGATTTTAGAGGCTGG - Intergenic
1004283357 6:14299454-14299476 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1004325292 6:14669081-14669103 GACTCCTGGGATGCAGAGTCAGG + Intergenic
1005348828 6:24914466-24914488 GAAACCTGCCTTGTAGAGCCTGG + Intronic
1005547705 6:26886945-26886967 ACATCCCGGATTGGAGAGTCAGG + Intergenic
1008257250 6:49318661-49318683 GAATAGTGGATACTAGAGTCTGG + Intergenic
1009018468 6:57928019-57928041 ACATCCCGGATTGGAGAGTCAGG + Intergenic
1009290521 6:61875309-61875331 GAAGCCAGGCTTATAGAGTCAGG + Intronic
1012014226 6:93832574-93832596 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1012025964 6:93991692-93991714 GAATTGTGGATATTAGAGTCTGG + Intergenic
1012066377 6:94556440-94556462 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1012315983 6:97782795-97782817 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1012675257 6:102105165-102105187 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1013891874 6:115035094-115035116 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1014556011 6:122843039-122843061 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1015266909 6:131298662-131298684 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1015323993 6:131904897-131904919 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1016135963 6:140543439-140543461 GATTTCTGGATTGTAGACTTTGG + Intergenic
1016249028 6:142019020-142019042 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1016535595 6:145105650-145105672 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1020532554 7:9355921-9355943 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1021810816 7:24399490-24399512 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1023900000 7:44468459-44468481 GAATCTTGGAGTCTAGAGACCGG - Intronic
1024472497 7:49777417-49777439 GAGTGCTGGAATTTAGAGTCAGG + Intronic
1026215271 7:68342911-68342933 GAATCCTGGACTCTAGCGGCTGG - Intergenic
1027852116 7:83462875-83462897 GAATAGTGGGTTGTAGAGGCAGG - Intronic
1030413994 7:109216830-109216852 AAAGCATGGATTCTAGAGTCAGG - Intergenic
1031400145 7:121318766-121318788 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1031525754 7:122820135-122820157 GAATAATGGGTTGTAGAGGCAGG - Intronic
1033313796 7:140281631-140281653 GAATCCAGGAATGTAGGCTCTGG - Intergenic
1037637758 8:20715708-20715730 GTCTCCTGGATTGGAGAGTTGGG - Intergenic
1039360041 8:36866295-36866317 GGATTCTGGATTGTTGGGTCTGG + Intronic
1044925323 8:97204129-97204151 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1045197692 8:99947084-99947106 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1045644946 8:104289146-104289168 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1046440178 8:114244551-114244573 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1047356375 8:124126030-124126052 TTATCCTGGATTATAGAGTGGGG - Intergenic
1047829384 8:128614414-128614436 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1048097761 8:131313407-131313429 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1051052792 9:12951557-12951579 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1051997626 9:23237789-23237811 GGATCCTGAATTGTAGGCTCGGG - Intergenic
1052268168 9:26597971-26597993 GAGACCTGGATTTTAGAGTTGGG - Intergenic
1055810218 9:80140625-80140647 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1056061320 9:82886960-82886982 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1056522613 9:87414136-87414158 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1056883142 9:90415787-90415809 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1057070764 9:92098081-92098103 GAATCCGGGAATGCTGAGTCAGG - Intronic
1057235012 9:93350820-93350842 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1057907606 9:98994537-98994559 GAATCATGGTTTGTTGCGTCTGG + Intronic
1058135662 9:101305078-101305100 AAATCCTGGATCTCAGAGTCAGG + Intronic
1058437916 9:104980732-104980754 GAAGCCAGGATTGTGGGGTCTGG - Intergenic
1058552019 9:106124754-106124776 GGGACCTGGATTGTAAAGTCAGG + Intergenic
1059863326 9:118488169-118488191 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1060226376 9:121793539-121793561 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1188703268 X:33292598-33292620 CAATCCTGGATTTTGGATTCTGG + Intronic
1194502816 X:94701320-94701342 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1196073249 X:111547134-111547156 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1196165709 X:112533827-112533849 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1196330989 X:114469974-114469996 GAATAATGGATTATAGAGGCAGG - Intergenic
1196341552 X:114603797-114603819 GAATAATGGGTTGTAGAGGCAGG + Intronic
1196533385 X:116814983-116815005 GAATAATGGGTTGTAGAGGCAGG + Intergenic
1197065077 X:122225247-122225269 GAATAATGGGTTGTAGAGGCAGG - Intergenic
1198858139 X:141040512-141040534 GAATCCTAGTTTATAGAATCAGG + Intergenic
1198904556 X:141546858-141546880 GAATCCTAGTTTATAGAATCAGG - Intergenic
1201667355 Y:16473590-16473612 GACTCCTGGATTCTGGATTCTGG - Intergenic